Incidental Mutation 'R6783:Ptcd3'
ID531504
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6783 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71908643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 33 (V33D)
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000082094] [ENSMUST00000206556] [ENSMUST00000206879]
Predicted Effect probably benign
Transcript: ENSMUST00000055296
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082094
AA Change: V33D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: V33D

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206284
AA Change: V25D
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Predicted Effect probably benign
Transcript: ENSMUST00000206879
AA Change: V33D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1393:Ptcd3 UTSW 6 71889621 missense probably benign 0.00
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R2406:Ptcd3 UTSW 6 71888647 missense probably damaging 1.00
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5441:Ptcd3 UTSW 6 71881521 missense possibly damaging 0.62
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6324:Ptcd3 UTSW 6 71885327 missense probably benign 0.00
R6537:Ptcd3 UTSW 6 71897110 splice site probably null
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATTCCCGAACTCGCAGATC -3'
(R):5'- GATGTGTACTGAGCGTTCCG -3'

Sequencing Primer
(F):5'- TTCCCGAACTCGCAGATCTAAAG -3'
(R):5'- TAGTCTAGCCAAACAGGACCTTGTG -3'
Posted On2018-08-29