Incidental Mutation 'R6783:Far2'
ID531507
Institutional Source Beutler Lab
Gene Symbol Far2
Ensembl Gene ENSMUSG00000030303
Gene Namefatty acyl CoA reductase 2
SynonymsMlstd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6783 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148047259-148182758 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to G at 148150775 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032443] [ENSMUST00000111607]
Predicted Effect probably null
Transcript: ENSMUST00000032443
SMART Domains Protein: ENSMUSP00000032443
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 160 5.3e-8 PFAM
Pfam:Epimerase 13 242 7.5e-9 PFAM
Pfam:3Beta_HSD 14 167 3.4e-7 PFAM
Pfam:NAD_binding_4 15 285 3.3e-76 PFAM
Pfam:Sterile 356 448 4.3e-35 PFAM
transmembrane domain 465 484 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111607
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Far2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Far2 APN 6 148150598 missense possibly damaging 0.89
IGL01650:Far2 APN 6 148173487 missense possibly damaging 0.92
IGL01899:Far2 APN 6 148146029 missense probably benign 0.19
IGL02524:Far2 APN 6 148150658 missense probably damaging 1.00
IGL02756:Far2 APN 6 148157391 missense probably damaging 1.00
Galway UTSW 6 148157482 missense probably damaging 0.99
PIT4531001:Far2 UTSW 6 148175131 missense possibly damaging 0.95
R0319:Far2 UTSW 6 148157470 missense probably damaging 0.96
R0654:Far2 UTSW 6 148175141 missense possibly damaging 0.64
R1321:Far2 UTSW 6 148173536 splice site probably benign
R1610:Far2 UTSW 6 148157458 missense possibly damaging 0.71
R2039:Far2 UTSW 6 148165577 missense probably benign
R2471:Far2 UTSW 6 148138694 missense probably damaging 1.00
R3874:Far2 UTSW 6 148150591 missense probably benign 0.00
R3875:Far2 UTSW 6 148150591 missense probably benign 0.00
R3974:Far2 UTSW 6 148150754 missense probably damaging 0.96
R4490:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R4491:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R5034:Far2 UTSW 6 148173441 missense probably benign 0.43
R5421:Far2 UTSW 6 148146192 splice site probably null
R5673:Far2 UTSW 6 148146104 missense possibly damaging 0.86
R6092:Far2 UTSW 6 148175083 missense probably benign 0.00
R6294:Far2 UTSW 6 148157482 missense probably damaging 0.99
R6325:Far2 UTSW 6 148157497 missense probably benign 0.30
R7380:Far2 UTSW 6 148180995 missense unknown
R7403:Far2 UTSW 6 148158977 missense possibly damaging 0.93
R7484:Far2 UTSW 6 148173913 missense probably damaging 1.00
R8276:Far2 UTSW 6 148173901 missense probably benign 0.00
X0053:Far2 UTSW 6 148165640 missense probably benign 0.00
Z1088:Far2 UTSW 6 148138658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATATGGCAGTCACTGGAG -3'
(R):5'- TCTTACTGGAAGAAGGGACTAGC -3'

Sequencing Primer
(F):5'- ATCCTCTCCAGAGAAGCTGTG -3'
(R):5'- GCAGAGAAAGTAAAGCATTTTCCC -3'
Posted On2018-08-29