Incidental Mutation 'R6783:Vmn2r53'
ID 531509
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R6783 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12601433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 100 (S100F)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: S100F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: S100F

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itga1 T G 13: 114,996,977 I466L probably benign Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATCTGTGTGGCCAGAGAG -3'
(R):5'- GGCGAATCTTTATGTTTCAGAGC -3'

Sequencing Primer
(F):5'- AGAGAGCTGGCCTGCTG -3'
(R):5'- TACAGGTAGTTGTGAGCCACC -3'
Posted On 2018-08-29