Incidental Mutation 'R6783:Itga1'
ID531533
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R6783 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 114996977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 466 (I466L)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: I466L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: I466L

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik G A 8: 11,655,661 Q39* probably null Het
5430419D17Rik T C 7: 131,226,764 L316P probably damaging Het
Adam12 T A 7: 133,974,397 Q228L probably damaging Het
Arhgap45 A G 10: 80,017,864 T71A possibly damaging Het
Bag6 T A 17: 35,144,235 S684T possibly damaging Het
BC067074 A T 13: 113,320,209 K930* probably null Het
Bcam C T 7: 19,766,881 G123R probably damaging Het
Cdr2l C T 11: 115,393,669 A277V possibly damaging Het
Clcn4 T A 7: 7,299,182 probably benign Het
Csnk1g1 T A 9: 65,973,512 I72N probably damaging Het
Ddx31 G A 2: 28,874,176 V465I probably benign Het
Ddx54 C T 5: 120,618,714 Q163* probably null Het
Dnmt3a A G 12: 3,897,406 E459G probably damaging Het
Dpp8 T C 9: 65,063,562 S568P possibly damaging Het
Drap1 G T 19: 5,424,191 T47K probably damaging Het
Epha7 G T 4: 28,950,528 R777L possibly damaging Het
Far2 T G 6: 148,150,775 probably null Het
Fhdc1 T C 3: 84,445,527 K797R probably benign Het
Gm10330 A T 12: 23,780,093 M29K probably damaging Het
Gm17689 T A 9: 36,581,335 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Grik3 A T 4: 125,632,300 I109F probably benign Het
Il31ra T C 13: 112,551,988 probably null Het
Itpr2 A T 6: 146,385,873 probably null Het
Mical3 A C 6: 120,958,825 L1580R possibly damaging Het
Olfr299 T A 7: 86,465,627 V72D probably damaging Het
Olfr732 T C 14: 50,282,187 D22G probably benign Het
Palb2 T A 7: 122,127,488 E386D probably damaging Het
Papd4 G A 13: 93,155,018 A368V probably benign Het
Papd4 C G 13: 93,155,019 A372P probably benign Het
Polm C A 11: 5,835,534 R175L probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Ptcd3 A T 6: 71,908,643 V33D probably benign Het
Ripk4 C A 16: 97,748,037 R273L probably damaging Het
Rpap2 A G 5: 107,655,287 T612A probably damaging Het
Serpinb10 A G 1: 107,546,867 N253S possibly damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sim1 T C 10: 50,908,727 I156T possibly damaging Het
Ski A T 4: 155,160,832 probably null Het
Trdn C T 10: 33,438,815 R512C probably damaging Het
Trim33 T C 3: 103,352,087 Y1031H probably damaging Het
Use1 T C 8: 71,369,236 L188P probably damaging Het
Usp34 G A 11: 23,412,318 G1588D probably damaging Het
Vmn2r33 C A 7: 7,563,798 R105L probably benign Het
Vmn2r53 G A 7: 12,601,433 S100F probably damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGATCAACTAGAAAGCCTTCTTC -3'
(R):5'- GCAGCACAGGAAAGACGTTTC -3'

Sequencing Primer
(F):5'- CTAGAAAGCCTTCTTCACAATGG -3'
(R):5'- GGAAAGACGTTTCACCAACAC -3'
Posted On2018-08-29