Incidental Mutation 'R6784:Sla2'
ID531545
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6784 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156883669 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 3 (S3N)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000109561]
Predicted Effect unknown
Transcript: ENSMUST00000029164
AA Change: S3N
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: S3N

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109561
AA Change: S3N
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: S3N

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Aass C T 6: 23,093,896 S142N probably null Het
Aida A G 1: 183,322,491 Y275C probably damaging Het
Arrdc4 A G 7: 68,748,846 I74T probably benign Het
C1ql4 A G 15: 99,087,409 V107A probably benign Het
Ccnh T C 13: 85,212,765 V284A probably benign Het
Cd180 A G 13: 102,702,705 E32G probably damaging Het
Chd6 T C 2: 160,966,254 D1680G probably damaging Het
Cog7 A T 7: 121,964,293 probably null Het
Cyp2j6 T A 4: 96,535,504 Q209L possibly damaging Het
Dars A T 1: 128,391,347 V116E probably damaging Het
Dnah10 A G 5: 124,777,826 K1932E probably damaging Het
Dock9 A G 14: 121,543,514 S2086P probably damaging Het
Espl1 C G 15: 102,299,225 R375G probably benign Het
Fer1l6 C T 15: 58,571,426 S526L possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gigyf2 G T 1: 87,443,674 V1170L probably damaging Het
Gm14412 G T 2: 177,317,340 T41K probably benign Het
Gm45861 A G 8: 27,500,058 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Hist1h2bc T C 13: 23,684,500 I90T probably damaging Het
Hoxc5 A G 15: 103,013,890 probably benign Het
Klra1 T C 6: 130,372,854 D207G probably benign Het
Lancl2 A G 6: 57,703,255 N57D probably benign Het
Map2k4 T C 11: 65,691,751 probably benign Het
Mgat3 G T 15: 80,212,200 Q409H probably damaging Het
Mpp3 T A 11: 102,002,148 probably null Het
Myh1 T A 11: 67,214,570 L1062Q probably damaging Het
Nebl T A 2: 17,434,914 K183* probably null Het
Npat G C 9: 53,558,158 D315H probably damaging Het
Nt5c2 A G 19: 46,924,327 V63A probably damaging Het
Olfr1123 C T 2: 87,418,452 R135C probably benign Het
Olfr389 T G 11: 73,776,850 H159P probably damaging Het
Olfr491 A T 7: 108,317,782 D296V probably damaging Het
Olfr574 A T 7: 102,948,515 T17S possibly damaging Het
Opn1sw T A 6: 29,379,847 E129D probably damaging Het
Prdm16 T C 4: 154,323,307 Y1153C probably damaging Het
Prdm6 T A 18: 53,536,626 D105E probably benign Het
Rbm27 T C 18: 42,301,864 M331T probably benign Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc10a6 A G 5: 103,629,030 I68T probably damaging Het
Slc5a1 T C 5: 33,158,116 F493S probably benign Het
Snx14 A T 9: 88,381,792 Y847N probably benign Het
Tmc1 A G 19: 20,827,651 probably null Het
Vps8 C A 16: 21,563,207 Q1130K probably benign Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0992:Sla2 UTSW 2 156874472 missense probably damaging 0.99
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2377:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2379:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2442:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3499:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTCACTGAAGCTTGTATTG -3'
(R):5'- TGATCACTGGCAAGGTCCTG -3'

Sequencing Primer
(F):5'- CACTGAAGCTTGTATTGGGGCG -3'
(R):5'- AAGGTCCTGGGAGGCTG -3'
Posted On2018-08-29