Incidental Mutation 'R6784:Chd6'
ID 531546
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission 044898-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.745) question?
Stock # R6784 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160808174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1680 (D1680G)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: D1680G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: D1680G

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,093,895 (GRCm39) S142N probably null Het
Aida A G 1: 183,103,346 (GRCm39) Y275C probably damaging Het
Arrdc4 A G 7: 68,398,594 (GRCm39) I74T probably benign Het
C1ql4 A G 15: 98,985,290 (GRCm39) V107A probably benign Het
Ccnh T C 13: 85,360,884 (GRCm39) V284A probably benign Het
Cd180 A G 13: 102,839,213 (GRCm39) E32G probably damaging Het
Cog7 A T 7: 121,563,516 (GRCm39) probably null Het
Cyp2j6 T A 4: 96,423,741 (GRCm39) Q209L possibly damaging Het
Dars1 A T 1: 128,319,084 (GRCm39) V116E probably damaging Het
Dnah10 A G 5: 124,854,890 (GRCm39) K1932E probably damaging Het
Dock9 A G 14: 121,780,926 (GRCm39) S2086P probably damaging Het
Espl1 C G 15: 102,207,660 (GRCm39) R375G probably benign Het
Fer1l6 C T 15: 58,443,275 (GRCm39) S526L possibly damaging Het
Galnt9 G A 5: 110,768,465 (GRCm39) R587H probably damaging Het
Gigyf2 G T 1: 87,371,396 (GRCm39) V1170L probably damaging Het
Gm14412 G T 2: 177,009,133 (GRCm39) T41K probably benign Het
Gm45861 A G 8: 27,990,086 (GRCm39) probably null Het
H2bc4 T C 13: 23,868,483 (GRCm39) I90T probably damaging Het
Hoxc5 A G 15: 102,922,322 (GRCm39) probably benign Het
Jkampl A T 6: 73,445,918 (GRCm39) Y210* probably null Het
Klra1 T C 6: 130,349,817 (GRCm39) D207G probably benign Het
Lancl2 A G 6: 57,680,240 (GRCm39) N57D probably benign Het
Map2k4 T C 11: 65,582,577 (GRCm39) probably benign Het
Mgat3 G T 15: 80,096,401 (GRCm39) Q409H probably damaging Het
Mpp3 T A 11: 101,892,974 (GRCm39) probably null Het
Myh1 T A 11: 67,105,396 (GRCm39) L1062Q probably damaging Het
Nebl T A 2: 17,439,725 (GRCm39) K183* probably null Het
Npat G C 9: 53,469,458 (GRCm39) D315H probably damaging Het
Nt5c2 A G 19: 46,912,766 (GRCm39) V63A probably damaging Het
Opn1sw T A 6: 29,379,846 (GRCm39) E129D probably damaging Het
Or10ag2 C T 2: 87,248,796 (GRCm39) R135C probably benign Het
Or1e29 T G 11: 73,667,676 (GRCm39) H159P probably damaging Het
Or51t4 A T 7: 102,597,722 (GRCm39) T17S possibly damaging Het
Or5p1 A T 7: 107,916,989 (GRCm39) D296V probably damaging Het
Prdm16 T C 4: 154,407,764 (GRCm39) Y1153C probably damaging Het
Prdm6 T A 18: 53,669,698 (GRCm39) D105E probably benign Het
Pwwp4c C T X: 73,684,021 (GRCm39) R355H probably damaging Homo
Rbm27 T C 18: 42,434,929 (GRCm39) M331T probably benign Het
S1pr1 A G 3: 115,505,710 (GRCm39) Y295H probably damaging Het
Sgpp1 G C 12: 75,782,243 (GRCm39) P32R probably benign Het
Sla2 C T 2: 156,725,589 (GRCm39) S3N unknown Het
Slc10a6 A G 5: 103,776,896 (GRCm39) I68T probably damaging Het
Slc5a1 T C 5: 33,315,460 (GRCm39) F493S probably benign Het
Snx14 A T 9: 88,263,845 (GRCm39) Y847N probably benign Het
Tmc1 A G 19: 20,805,015 (GRCm39) probably null Het
Vps8 C A 16: 21,381,957 (GRCm39) Q1130K probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,809,800 (GRCm39) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,807,502 (GRCm39) missense probably benign
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8865:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9310:Chd6 UTSW 2 160,881,181 (GRCm39) missense probably damaging 1.00
R9367:Chd6 UTSW 2 160,871,784 (GRCm39) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTCTGCCTCAATACCAGGAG -3'
(R):5'- GCACCTGGAAGTCTCTGTTG -3'

Sequencing Primer
(F):5'- GAGGCTGGCAGCTCTCATTTC -3'
(R):5'- GAAGTCTCTGTTGCCTTTACCAGAG -3'
Posted On 2018-08-29