Incidental Mutation 'R6784:Olfr491'
ID531562
Institutional Source Beutler Lab
Gene Symbol Olfr491
Ensembl Gene ENSMUSG00000094612
Gene Nameolfactory receptor 491
SynonymsMOR204-11, GA_x6K02T2PBJ9-10646917-10647849
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6784 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108313451-108318827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108317782 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 296 (D296V)
Ref Sequence ENSEMBL: ENSMUSP00000150694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053179] [ENSMUST00000079865] [ENSMUST00000209545] [ENSMUST00000214605]
Predicted Effect probably damaging
Transcript: ENSMUST00000053179
AA Change: D296V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061188
Gene: ENSMUSG00000094612
AA Change: D296V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 290 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079865
Predicted Effect probably damaging
Transcript: ENSMUST00000209545
AA Change: D296V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214605
AA Change: D296V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Aass C T 6: 23,093,896 S142N probably null Het
Aida A G 1: 183,322,491 Y275C probably damaging Het
Arrdc4 A G 7: 68,748,846 I74T probably benign Het
C1ql4 A G 15: 99,087,409 V107A probably benign Het
Ccnh T C 13: 85,212,765 V284A probably benign Het
Cd180 A G 13: 102,702,705 E32G probably damaging Het
Chd6 T C 2: 160,966,254 D1680G probably damaging Het
Cog7 A T 7: 121,964,293 probably null Het
Cyp2j6 T A 4: 96,535,504 Q209L possibly damaging Het
Dars A T 1: 128,391,347 V116E probably damaging Het
Dnah10 A G 5: 124,777,826 K1932E probably damaging Het
Dock9 A G 14: 121,543,514 S2086P probably damaging Het
Espl1 C G 15: 102,299,225 R375G probably benign Het
Fer1l6 C T 15: 58,571,426 S526L possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gigyf2 G T 1: 87,443,674 V1170L probably damaging Het
Gm14412 G T 2: 177,317,340 T41K probably benign Het
Gm45861 A G 8: 27,500,058 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Hist1h2bc T C 13: 23,684,500 I90T probably damaging Het
Hoxc5 A G 15: 103,013,890 probably benign Het
Klra1 T C 6: 130,372,854 D207G probably benign Het
Lancl2 A G 6: 57,703,255 N57D probably benign Het
Map2k4 T C 11: 65,691,751 probably benign Het
Mgat3 G T 15: 80,212,200 Q409H probably damaging Het
Mpp3 T A 11: 102,002,148 probably null Het
Myh1 T A 11: 67,214,570 L1062Q probably damaging Het
Nebl T A 2: 17,434,914 K183* probably null Het
Npat G C 9: 53,558,158 D315H probably damaging Het
Nt5c2 A G 19: 46,924,327 V63A probably damaging Het
Olfr1123 C T 2: 87,418,452 R135C probably benign Het
Olfr389 T G 11: 73,776,850 H159P probably damaging Het
Olfr574 A T 7: 102,948,515 T17S possibly damaging Het
Opn1sw T A 6: 29,379,847 E129D probably damaging Het
Prdm16 T C 4: 154,323,307 Y1153C probably damaging Het
Prdm6 T A 18: 53,536,626 D105E probably benign Het
Rbm27 T C 18: 42,301,864 M331T probably benign Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sla2 C T 2: 156,883,669 S3N unknown Het
Slc10a6 A G 5: 103,629,030 I68T probably damaging Het
Slc5a1 T C 5: 33,158,116 F493S probably benign Het
Snx14 A T 9: 88,381,792 Y847N probably benign Het
Tmc1 A G 19: 20,827,651 probably null Het
Vps8 C A 16: 21,563,207 Q1130K probably benign Het
Other mutations in Olfr491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Olfr491 APN 7 108317518 missense probably benign 0.02
IGL01731:Olfr491 APN 7 108317475 missense probably benign 0.01
IGL02227:Olfr491 APN 7 108317201 nonsense probably null
IGL02624:Olfr491 APN 7 108316923 missense probably benign 0.38
IGL03164:Olfr491 APN 7 108317694 missense probably damaging 1.00
R0143:Olfr491 UTSW 7 108316995 missense probably benign 0.00
R0217:Olfr491 UTSW 7 108317298 missense probably benign 0.00
R0295:Olfr491 UTSW 7 108317685 missense probably benign 0.42
R2100:Olfr491 UTSW 7 108317554 missense probably benign 0.04
R2379:Olfr491 UTSW 7 108317292 missense probably benign 0.25
R4178:Olfr491 UTSW 7 108317358 missense probably damaging 1.00
R4365:Olfr491 UTSW 7 108317106 missense probably benign 0.02
R4734:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R4828:Olfr491 UTSW 7 108317470 missense probably benign 0.00
R6424:Olfr491 UTSW 7 108317205 missense probably benign 0.01
R7109:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R7348:Olfr491 UTSW 7 108317713 missense possibly damaging 0.58
R7590:Olfr491 UTSW 7 108317179 missense probably benign 0.00
X0060:Olfr491 UTSW 7 108317220 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCCTGAAGATGCGCTCCAC -3'
(R):5'- CACACAGCAAGGGTACATTATTG -3'

Sequencing Primer
(F):5'- TGAAGATGCGCTCCACTGAGG -3'
(R):5'- CACAGCAAGGGTACATTATTGTTTAG -3'
Posted On2018-08-29