Mutagenetix > Incidental Mutation

Incidental Mutation 'R6784:Fer1l6'

531576

Institutional Source

Beutler Lab

Gene Symbol

Fer1l6

Ensembl Gene

ENSMUSG00000037106

Gene Name

fer-1-like 6 (C. elegans)

Synonyms

EG631797

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58510048-58665092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58571426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 526 (S526L)

Ref Sequence

ENSEMBL: ENSMUSP00000125718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161028]

AlphaFold

E0CZ42

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161028
AA Change: S526L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: S526L

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
C2	83	179	4.09e-12	SMART
FerI	165	235	2.06e-36	SMART
C2	243	354	5.19e-14	SMART
low complexity region	412	449	N/A	INTRINSIC
FerB	714	787	2.53e-45	SMART
C2	829	936	8.84e-8	SMART
C2	1000	1099	3.05e0	SMART
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1256	1270	N/A	INTRINSIC
C2	1361	1460	5.78e-12	SMART
low complexity region	1518	1529	N/A	INTRINSIC
C2	1601	1731	1.01e-2	SMART
Pfam:Ferlin_C	1765	1857	2.3e-40	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.2%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931417E11Rik	A	T	6: 73,468,935	Y210*	probably null	Het
Aass	C	T	6: 23,093,896	S142N	probably null	Het
Aida	A	G	1: 183,322,491	Y275C	probably damaging	Het
Arrdc4	A	G	7: 68,748,846	I74T	probably benign	Het
C1ql4	A	G	15: 99,087,409	V107A	probably benign	Het
Ccnh	T	C	13: 85,212,765	V284A	probably benign	Het
Cd180	A	G	13: 102,702,705	E32G	probably damaging	Het
Chd6	T	C	2: 160,966,254	D1680G	probably damaging	Het
Cog7	A	T	7: 121,964,293		probably null	Het
Cyp2j6	T	A	4: 96,535,504	Q209L	possibly damaging	Het
Dars	A	T	1: 128,391,347	V116E	probably damaging	Het
Dnah10	A	G	5: 124,777,826	K1932E	probably damaging	Het
Dock9	A	G	14: 121,543,514	S2086P	probably damaging	Het
Espl1	C	G	15: 102,299,225	R375G	probably benign	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gigyf2	G	T	1: 87,443,674	V1170L	probably damaging	Het
Gm14412	G	T	2: 177,317,340	T41K	probably benign	Het
Gm45861	A	G	8: 27,500,058		probably null	Het
Gm5640	C	T	X: 74,640,415	R355H	probably damaging	Homo
Hist1h2bc	T	C	13: 23,684,500	I90T	probably damaging	Het
Hoxc5	A	G	15: 103,013,890		probably benign	Het
Klra1	T	C	6: 130,372,854	D207G	probably benign	Het
Lancl2	A	G	6: 57,703,255	N57D	probably benign	Het
Map2k4	T	C	11: 65,691,751		probably benign	Het
Mgat3	G	T	15: 80,212,200	Q409H	probably damaging	Het
Mpp3	T	A	11: 102,002,148		probably null	Het
Myh1	T	A	11: 67,214,570	L1062Q	probably damaging	Het
Nebl	T	A	2: 17,434,914	K183*	probably null	Het
Npat	G	C	9: 53,558,158	D315H	probably damaging	Het
Nt5c2	A	G	19: 46,924,327	V63A	probably damaging	Het
Olfr1123	C	T	2: 87,418,452	R135C	probably benign	Het
Olfr389	T	G	11: 73,776,850	H159P	probably damaging	Het
Olfr491	A	T	7: 108,317,782	D296V	probably damaging	Het
Olfr574	A	T	7: 102,948,515	T17S	possibly damaging	Het
Opn1sw	T	A	6: 29,379,847	E129D	probably damaging	Het
Prdm16	T	C	4: 154,323,307	Y1153C	probably damaging	Het
Prdm6	T	A	18: 53,536,626	D105E	probably benign	Het
Rbm27	T	C	18: 42,301,864	M331T	probably benign	Het
S1pr1	A	G	3: 115,712,061	Y295H	probably damaging	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Sla2	C	T	2: 156,883,669	S3N	unknown	Het
Slc10a6	A	G	5: 103,629,030	I68T	probably damaging	Het
Slc5a1	T	C	5: 33,158,116	F493S	probably benign	Het
Snx14	A	T	9: 88,381,792	Y847N	probably benign	Het
Tmc1	A	G	19: 20,827,651		probably null	Het
Vps8	C	A	16: 21,563,207	Q1130K	probably benign	Het

Other mutations in Fer1l6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0009:Fer1l6	UTSW	15	58662787	missense	probably damaging	1.00
R0141:Fer1l6	UTSW	15	58558402	missense	probably damaging	1.00
R0178:Fer1l6	UTSW	15	58637914	splice site	probably null
R0304:Fer1l6	UTSW	15	58590562	missense	probably benign	0.08
R0379:Fer1l6	UTSW	15	58548338	missense	probably benign	0.05
R0457:Fer1l6	UTSW	15	58638094	critical splice donor site	probably null
R0546:Fer1l6	UTSW	15	58558408	splice site	probably null
R0602:Fer1l6	UTSW	15	58577945	missense	probably damaging	0.98
R0619:Fer1l6	UTSW	15	58662935	splice site	probably null
R0669:Fer1l6	UTSW	15	58553724	splice site	probably null
R0854:Fer1l6	UTSW	15	58559188	missense	probably benign	0.00
R0948:Fer1l6	UTSW	15	58564075	missense	probably benign	0.00
R1180:Fer1l6	UTSW	15	58602311	splice site	probably benign
R1483:Fer1l6	UTSW	15	58637970	missense	possibly damaging	0.84
R1627:Fer1l6	UTSW	15	58641879	missense	probably benign	0.41
R1635:Fer1l6	UTSW	15	58647081	missense	probably damaging	1.00
R1834:Fer1l6	UTSW	15	58557869	missense	possibly damaging	0.58
R1921:Fer1l6	UTSW	15	58625231	missense	probably damaging	1.00
R2000:Fer1l6	UTSW	15	58602311	splice site	probably benign
R2041:Fer1l6	UTSW	15	58558306	missense	probably damaging	1.00
R2144:Fer1l6	UTSW	15	58627534	missense	probably benign
R2145:Fer1l6	UTSW	15	58627534	missense	probably benign
R2981:Fer1l6	UTSW	15	58564077	missense	probably damaging	0.99
R4164:Fer1l6	UTSW	15	58559238	missense	possibly damaging	0.83
R4192:Fer1l6	UTSW	15	58647149	missense	probably damaging	1.00
R4273:Fer1l6	UTSW	15	58627522	missense	probably benign	0.41
R4573:Fer1l6	UTSW	15	58626280	critical splice donor site	probably null
R4581:Fer1l6	UTSW	15	58640226	missense	probably damaging	1.00
R4624:Fer1l6	UTSW	15	58553705	missense	probably damaging	1.00
R4755:Fer1l6	UTSW	15	58640211	missense	probably benign	0.09
R4774:Fer1l6	UTSW	15	58577949	missense	probably damaging	0.99
R4894:Fer1l6	UTSW	15	58618902	missense	probably damaging	1.00
R4896:Fer1l6	UTSW	15	58638020	missense	probably damaging	1.00
R4921:Fer1l6	UTSW	15	58600311	critical splice acceptor site	probably null
R4962:Fer1l6	UTSW	15	58571401	missense	probably benign	0.03
R5029:Fer1l6	UTSW	15	58643920	missense	probably benign	0.00
R5134:Fer1l6	UTSW	15	58640154	missense	probably damaging	1.00
R5175:Fer1l6	UTSW	15	58550277	missense	probably damaging	1.00
R5227:Fer1l6	UTSW	15	58581903	nonsense	probably null
R5561:Fer1l6	UTSW	15	58660825	missense	probably damaging	0.97
R5621:Fer1l6	UTSW	15	58558326	missense	probably damaging	1.00
R5670:Fer1l6	UTSW	15	58622482	missense	probably benign	0.00
R5745:Fer1l6	UTSW	15	58571389	missense	probably benign	0.01
R5807:Fer1l6	UTSW	15	58590550	nonsense	probably null
R5823:Fer1l6	UTSW	15	58590503	nonsense	probably null
R5892:Fer1l6	UTSW	15	58564068	missense	probably benign
R6006:Fer1l6	UTSW	15	58647044	missense	probably damaging	1.00
R6137:Fer1l6	UTSW	15	58559206	missense	probably damaging	0.97
R6195:Fer1l6	UTSW	15	58637957	missense	probably damaging	1.00
R6234:Fer1l6	UTSW	15	58560639	missense	probably damaging	1.00
R6237:Fer1l6	UTSW	15	58625177	nonsense	probably null
R6237:Fer1l6	UTSW	15	58638006	missense	probably damaging	1.00
R6271:Fer1l6	UTSW	15	58641918	missense	probably benign	0.01
R6336:Fer1l6	UTSW	15	58559232	nonsense	probably null
R6852:Fer1l6	UTSW	15	58594878	missense	probably damaging	1.00
R7030:Fer1l6	UTSW	15	58629378	missense	probably damaging	1.00
R7088:Fer1l6	UTSW	15	58564050	missense	possibly damaging	0.69
R7181:Fer1l6	UTSW	15	58575297	missense	probably benign	0.00
R7226:Fer1l6	UTSW	15	58590535	missense	probably benign	0.00
R7266:Fer1l6	UTSW	15	58627597	missense	probably benign
R7463:Fer1l6	UTSW	15	58573601	nonsense	probably null
R7464:Fer1l6	UTSW	15	58573247	splice site	probably null
R7469:Fer1l6	UTSW	15	58590570	splice site	probably null
R7483:Fer1l6	UTSW	15	58641945	missense	possibly damaging	0.83
R7491:Fer1l6	UTSW	15	58600432	missense	probably damaging	1.00
R7534:Fer1l6	UTSW	15	58638026	missense	probably damaging	1.00
R7562:Fer1l6	UTSW	15	58560482	missense	probably benign	0.00
R7580:Fer1l6	UTSW	15	58558396	missense	probably benign	0.41
R7599:Fer1l6	UTSW	15	58627589	missense	probably benign
R7607:Fer1l6	UTSW	15	58662732	nonsense	probably null
R7677:Fer1l6	UTSW	15	58602290	missense	probably benign	0.00
R8202:Fer1l6	UTSW	15	58630637	missense	probably damaging	1.00
R8261:Fer1l6	UTSW	15	58560496	missense	possibly damaging	0.84
R8847:Fer1l6	UTSW	15	58542163	missense	possibly damaging	0.72
R9022:Fer1l6	UTSW	15	58583480	missense	probably damaging	0.99
R9030:Fer1l6	UTSW	15	58630745	missense	probably damaging	1.00
R9160:Fer1l6	UTSW	15	58643866	missense	possibly damaging	0.94
R9180:Fer1l6	UTSW	15	58622381	missense	probably benign	0.19
R9289:Fer1l6	UTSW	15	58618917	missense	probably damaging	1.00
R9559:Fer1l6	UTSW	15	58557910	missense	possibly damaging	0.88
R9562:Fer1l6	UTSW	15	58618521	missense	possibly damaging	0.70
R9682:Fer1l6	UTSW	15	58550264	missense	probably benign	0.03
R9775:Fer1l6	UTSW	15	58625249	missense	probably benign
X0021:Fer1l6	UTSW	15	58569202	nonsense	probably null
X0027:Fer1l6	UTSW	15	58629340	missense	probably damaging	1.00
X0063:Fer1l6	UTSW	15	58618574	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGTTTTCTTGTTCTCCATGGG -3'
(R):5'- ACCCAGCAGAAACTTTGCTC -3'

Sequencing Primer
(F):5'- ATCTTGAGATCTTAGCTCCTTGC -3'
(R):5'- AGCAGAAACTTTGCTCTCACCTG -3'

Posted On

2018-08-29