Incidental Mutation 'R6784:Fer1l6'
ID 531576
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 044898-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6784 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58443275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 526 (S526L)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: S526L

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: S526L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,093,895 (GRCm39) S142N probably null Het
Aida A G 1: 183,103,346 (GRCm39) Y275C probably damaging Het
Arrdc4 A G 7: 68,398,594 (GRCm39) I74T probably benign Het
C1ql4 A G 15: 98,985,290 (GRCm39) V107A probably benign Het
Ccnh T C 13: 85,360,884 (GRCm39) V284A probably benign Het
Cd180 A G 13: 102,839,213 (GRCm39) E32G probably damaging Het
Chd6 T C 2: 160,808,174 (GRCm39) D1680G probably damaging Het
Cog7 A T 7: 121,563,516 (GRCm39) probably null Het
Cyp2j6 T A 4: 96,423,741 (GRCm39) Q209L possibly damaging Het
Dars1 A T 1: 128,319,084 (GRCm39) V116E probably damaging Het
Dnah10 A G 5: 124,854,890 (GRCm39) K1932E probably damaging Het
Dock9 A G 14: 121,780,926 (GRCm39) S2086P probably damaging Het
Espl1 C G 15: 102,207,660 (GRCm39) R375G probably benign Het
Galnt9 G A 5: 110,768,465 (GRCm39) R587H probably damaging Het
Gigyf2 G T 1: 87,371,396 (GRCm39) V1170L probably damaging Het
Gm14412 G T 2: 177,009,133 (GRCm39) T41K probably benign Het
Gm45861 A G 8: 27,990,086 (GRCm39) probably null Het
H2bc4 T C 13: 23,868,483 (GRCm39) I90T probably damaging Het
Hoxc5 A G 15: 102,922,322 (GRCm39) probably benign Het
Jkampl A T 6: 73,445,918 (GRCm39) Y210* probably null Het
Klra1 T C 6: 130,349,817 (GRCm39) D207G probably benign Het
Lancl2 A G 6: 57,680,240 (GRCm39) N57D probably benign Het
Map2k4 T C 11: 65,582,577 (GRCm39) probably benign Het
Mgat3 G T 15: 80,096,401 (GRCm39) Q409H probably damaging Het
Mpp3 T A 11: 101,892,974 (GRCm39) probably null Het
Myh1 T A 11: 67,105,396 (GRCm39) L1062Q probably damaging Het
Nebl T A 2: 17,439,725 (GRCm39) K183* probably null Het
Npat G C 9: 53,469,458 (GRCm39) D315H probably damaging Het
Nt5c2 A G 19: 46,912,766 (GRCm39) V63A probably damaging Het
Opn1sw T A 6: 29,379,846 (GRCm39) E129D probably damaging Het
Or10ag2 C T 2: 87,248,796 (GRCm39) R135C probably benign Het
Or1e29 T G 11: 73,667,676 (GRCm39) H159P probably damaging Het
Or51t4 A T 7: 102,597,722 (GRCm39) T17S possibly damaging Het
Or5p1 A T 7: 107,916,989 (GRCm39) D296V probably damaging Het
Prdm16 T C 4: 154,407,764 (GRCm39) Y1153C probably damaging Het
Prdm6 T A 18: 53,669,698 (GRCm39) D105E probably benign Het
Pwwp4c C T X: 73,684,021 (GRCm39) R355H probably damaging Homo
Rbm27 T C 18: 42,434,929 (GRCm39) M331T probably benign Het
S1pr1 A G 3: 115,505,710 (GRCm39) Y295H probably damaging Het
Sgpp1 G C 12: 75,782,243 (GRCm39) P32R probably benign Het
Sla2 C T 2: 156,725,589 (GRCm39) S3N unknown Het
Slc10a6 A G 5: 103,776,896 (GRCm39) I68T probably damaging Het
Slc5a1 T C 5: 33,315,460 (GRCm39) F493S probably benign Het
Snx14 A T 9: 88,263,845 (GRCm39) Y847N probably benign Het
Tmc1 A G 19: 20,805,015 (GRCm39) probably null Het
Vps8 C A 16: 21,381,957 (GRCm39) Q1130K probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAGTTTTCTTGTTCTCCATGGG -3'
(R):5'- ACCCAGCAGAAACTTTGCTC -3'

Sequencing Primer
(F):5'- ATCTTGAGATCTTAGCTCCTTGC -3'
(R):5'- AGCAGAAACTTTGCTCTCACCTG -3'
Posted On 2018-08-29