Incidental Mutation 'R6784:Hoxc5'
ID531580
Institutional Source Beutler Lab
Gene Symbol Hoxc5
Ensembl Gene ENSMUSG00000022485
Gene Namehomeobox C5
SynonymsHox-3.4, Hox-6.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R6784 (G1)
Quality Score80.0075
Status Validated
Chromosome15
Chromosomal Location102967443-103017429 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 103013890 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711]
Predicted Effect probably benign
Transcript: ENSMUST00000001709
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000001711
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,468,935 Y210* probably null Het
Aass C T 6: 23,093,896 S142N probably null Het
Aida A G 1: 183,322,491 Y275C probably damaging Het
Arrdc4 A G 7: 68,748,846 I74T probably benign Het
C1ql4 A G 15: 99,087,409 V107A probably benign Het
Ccnh T C 13: 85,212,765 V284A probably benign Het
Cd180 A G 13: 102,702,705 E32G probably damaging Het
Chd6 T C 2: 160,966,254 D1680G probably damaging Het
Cog7 A T 7: 121,964,293 probably null Het
Cyp2j6 T A 4: 96,535,504 Q209L possibly damaging Het
Dars A T 1: 128,391,347 V116E probably damaging Het
Dnah10 A G 5: 124,777,826 K1932E probably damaging Het
Dock9 A G 14: 121,543,514 S2086P probably damaging Het
Espl1 C G 15: 102,299,225 R375G probably benign Het
Fer1l6 C T 15: 58,571,426 S526L possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gigyf2 G T 1: 87,443,674 V1170L probably damaging Het
Gm14412 G T 2: 177,317,340 T41K probably benign Het
Gm45861 A G 8: 27,500,058 probably null Het
Gm5640 C T X: 74,640,415 R355H probably damaging Homo
Hist1h2bc T C 13: 23,684,500 I90T probably damaging Het
Klra1 T C 6: 130,372,854 D207G probably benign Het
Lancl2 A G 6: 57,703,255 N57D probably benign Het
Map2k4 T C 11: 65,691,751 probably benign Het
Mgat3 G T 15: 80,212,200 Q409H probably damaging Het
Mpp3 T A 11: 102,002,148 probably null Het
Myh1 T A 11: 67,214,570 L1062Q probably damaging Het
Nebl T A 2: 17,434,914 K183* probably null Het
Npat G C 9: 53,558,158 D315H probably damaging Het
Nt5c2 A G 19: 46,924,327 V63A probably damaging Het
Olfr1123 C T 2: 87,418,452 R135C probably benign Het
Olfr389 T G 11: 73,776,850 H159P probably damaging Het
Olfr491 A T 7: 108,317,782 D296V probably damaging Het
Olfr574 A T 7: 102,948,515 T17S possibly damaging Het
Opn1sw T A 6: 29,379,847 E129D probably damaging Het
Prdm16 T C 4: 154,323,307 Y1153C probably damaging Het
Prdm6 T A 18: 53,536,626 D105E probably benign Het
Rbm27 T C 18: 42,301,864 M331T probably benign Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Sla2 C T 2: 156,883,669 S3N unknown Het
Slc10a6 A G 5: 103,629,030 I68T probably damaging Het
Slc5a1 T C 5: 33,158,116 F493S probably benign Het
Snx14 A T 9: 88,381,792 Y847N probably benign Het
Tmc1 A G 19: 20,827,651 probably null Het
Vps8 C A 16: 21,563,207 Q1130K probably benign Het
Other mutations in Hoxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Hoxc5 APN 15 103014136 missense probably damaging 0.98
R0386:Hoxc5 UTSW 15 103015352 nonsense probably null
R1797:Hoxc5 UTSW 15 103014434 missense probably benign 0.00
R2021:Hoxc5 UTSW 15 103014382 splice site probably null
R4851:Hoxc5 UTSW 15 103015369 missense probably damaging 1.00
R4967:Hoxc5 UTSW 15 103015354 missense probably damaging 1.00
R5089:Hoxc5 UTSW 15 103014055 unclassified probably benign
R6718:Hoxc5 UTSW 15 103014266 splice site probably null
R6927:Hoxc5 UTSW 15 103015375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATGAAATTCCTCCGAGTCG -3'
(R):5'- TTGGCTACGTAGGAGCTCATG -3'

Sequencing Primer
(F):5'- ACCAGGTGTCGCTGTGAG -3'
(R):5'- CTCATGGCGGGGAGGGC -3'
Posted On2018-08-29