Mutagenetix > Incidental Mutation

Incidental Mutation 'R6784:Tmc1'

531584

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

044898-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R6784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 20827651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably null
Transcript: ENSMUST00000039500

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.2%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931417E11Rik	A	T	6: 73,468,935	Y210*	probably null	Het
Aass	C	T	6: 23,093,896	S142N	probably null	Het
Aida	A	G	1: 183,322,491	Y275C	probably damaging	Het
Arrdc4	A	G	7: 68,748,846	I74T	probably benign	Het
C1ql4	A	G	15: 99,087,409	V107A	probably benign	Het
Ccnh	T	C	13: 85,212,765	V284A	probably benign	Het
Cd180	A	G	13: 102,702,705	E32G	probably damaging	Het
Chd6	T	C	2: 160,966,254	D1680G	probably damaging	Het
Cog7	A	T	7: 121,964,293		probably null	Het
Cyp2j6	T	A	4: 96,535,504	Q209L	possibly damaging	Het
Dars	A	T	1: 128,391,347	V116E	probably damaging	Het
Dnah10	A	G	5: 124,777,826	K1932E	probably damaging	Het
Dock9	A	G	14: 121,543,514	S2086P	probably damaging	Het
Espl1	C	G	15: 102,299,225	R375G	probably benign	Het
Fer1l6	C	T	15: 58,571,426	S526L	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gigyf2	G	T	1: 87,443,674	V1170L	probably damaging	Het
Gm14412	G	T	2: 177,317,340	T41K	probably benign	Het
Gm45861	A	G	8: 27,500,058		probably null	Het
Gm5640	C	T	X: 74,640,415	R355H	probably damaging	Homo
Hist1h2bc	T	C	13: 23,684,500	I90T	probably damaging	Het
Hoxc5	A	G	15: 103,013,890		probably benign	Het
Klra1	T	C	6: 130,372,854	D207G	probably benign	Het
Lancl2	A	G	6: 57,703,255	N57D	probably benign	Het
Map2k4	T	C	11: 65,691,751		probably benign	Het
Mgat3	G	T	15: 80,212,200	Q409H	probably damaging	Het
Mpp3	T	A	11: 102,002,148		probably null	Het
Myh1	T	A	11: 67,214,570	L1062Q	probably damaging	Het
Nebl	T	A	2: 17,434,914	K183*	probably null	Het
Npat	G	C	9: 53,558,158	D315H	probably damaging	Het
Nt5c2	A	G	19: 46,924,327	V63A	probably damaging	Het
Olfr1123	C	T	2: 87,418,452	R135C	probably benign	Het
Olfr389	T	G	11: 73,776,850	H159P	probably damaging	Het
Olfr491	A	T	7: 108,317,782	D296V	probably damaging	Het
Olfr574	A	T	7: 102,948,515	T17S	possibly damaging	Het
Opn1sw	T	A	6: 29,379,847	E129D	probably damaging	Het
Prdm16	T	C	4: 154,323,307	Y1153C	probably damaging	Het
Prdm6	T	A	18: 53,536,626	D105E	probably benign	Het
Rbm27	T	C	18: 42,301,864	M331T	probably benign	Het
S1pr1	A	G	3: 115,712,061	Y295H	probably damaging	Het
Sgpp1	G	C	12: 75,735,469	P32R	probably benign	Het
Sla2	C	T	2: 156,883,669	S3N	unknown	Het
Slc10a6	A	G	5: 103,629,030	I68T	probably damaging	Het
Slc5a1	T	C	5: 33,158,116	F493S	probably benign	Het
Snx14	A	T	9: 88,381,792	Y847N	probably benign	Het
Vps8	C	A	16: 21,563,207	Q1130K	probably benign	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGACAAAGATACAGCTGCTC -3'
(R):5'- ACAGTTTTCCCGTGACTGCTG -3'

Sequencing Primer
(F):5'- CAGCTGCTCTGGGTCAC -3'
(R):5'- TTTCTGGCTGCTGAATTACATTC -3'

Posted On

2018-08-29