Incidental Mutation 'R6785:Fasl'
ID531590
Institutional Source Beutler Lab
Gene Symbol Fasl
Ensembl Gene ENSMUSG00000000817
Gene NameFas ligand (TNF superfamily, member 6)
SynonymsAPT1LG1, CD178, CD95L, Fas-L, Tnfsf6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6785 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161780689-161788495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 161781835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 194 (Y194F)
Ref Sequence ENSEMBL: ENSMUSP00000000834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]
Predicted Effect probably benign
Transcript: ENSMUST00000000834
AA Change: Y194F

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: Y194F

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193648
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Meta Mutation Damage Score 0.2367 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
D3Ertd254e T A 3: 36,165,452 C541* probably null Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gen1 A G 12: 11,262,530 V13A possibly damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Lmf2 A T 15: 89,352,033 S588T probably benign Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Plekhf1 G A 7: 38,222,064 Q27* probably null Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Scube2 A G 7: 109,810,617 I557T probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in Fasl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign
riogrande2 UTSW 1 161787138 missense probably benign 0.00
ANU22:Fasl UTSW 1 161781838 missense probably damaging 0.99
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R3911:Fasl UTSW 1 161788191 missense probably benign 0.10
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6969:Fasl UTSW 1 161781675 missense probably damaging 0.98
R7248:Fasl UTSW 1 161788191 missense possibly damaging 0.90
R7336:Fasl UTSW 1 161787988 missense probably damaging 1.00
R8135:Fasl UTSW 1 161787128 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGTAAGATTGAATACTGCCCC -3'
(R):5'- CGTGCTGAAGAAACTCAGTGG -3'

Sequencing Primer
(F):5'- CCAGGTAGCTGCTGTGGG -3'
(R):5'- ACTTTAGTTAAGGGATGCATGTCAG -3'
Posted On2018-08-29