Incidental Mutation 'R6785:D3Ertd254e'
ID531603
Institutional Source Beutler Lab
Gene Symbol D3Ertd254e
Ensembl Gene ENSMUSG00000033883
Gene NameDNA segment, Chr 3, ERATO Doi 254, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6785 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36151017-36170342 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36165452 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 541 (C541*)
Ref Sequence ENSEMBL: ENSMUSP00000142829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165956] [ENSMUST00000197653] [ENSMUST00000205077]
Predicted Effect probably null
Transcript: ENSMUST00000165956
AA Change: C540*
SMART Domains Protein: ENSMUSP00000131779
Gene: ENSMUSG00000033883
AA Change: C540*

DomainStartEndE-ValueType
KRAB 3 63 2.91e-34 SMART
ZnF_C2H2 342 364 1.08e-1 SMART
ZnF_C2H2 395 417 1.56e-2 SMART
ZnF_C2H2 423 445 3.11e-2 SMART
ZnF_C2H2 451 473 5.9e-3 SMART
ZnF_C2H2 479 501 1.82e-3 SMART
ZnF_C2H2 507 529 5.21e-4 SMART
ZnF_C2H2 535 557 1.84e-4 SMART
ZnF_C2H2 563 585 1.95e-3 SMART
ZnF_C2H2 591 613 2.05e-2 SMART
ZnF_C2H2 619 641 1.6e-4 SMART
ZnF_C2H2 647 669 5.21e-4 SMART
ZnF_C2H2 675 697 1.69e-3 SMART
ZnF_C2H2 703 725 2.61e-4 SMART
ZnF_C2H2 731 753 1.12e-3 SMART
ZnF_C2H2 759 779 3.85e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197653
AA Change: C541*
SMART Domains Protein: ENSMUSP00000142829
Gene: ENSMUSG00000033883
AA Change: C541*

DomainStartEndE-ValueType
KRAB 4 64 1.2e-36 SMART
ZnF_C2H2 343 365 4.4e-4 SMART
ZnF_C2H2 396 418 6.7e-5 SMART
ZnF_C2H2 424 446 1.3e-4 SMART
ZnF_C2H2 452 474 2.5e-5 SMART
ZnF_C2H2 480 502 7.9e-6 SMART
ZnF_C2H2 508 530 2.2e-6 SMART
ZnF_C2H2 536 558 7.7e-7 SMART
ZnF_C2H2 564 586 8e-6 SMART
ZnF_C2H2 592 614 8.9e-5 SMART
ZnF_C2H2 620 642 6.6e-7 SMART
ZnF_C2H2 648 670 2.2e-6 SMART
ZnF_C2H2 676 698 7.1e-6 SMART
ZnF_C2H2 704 726 1.1e-6 SMART
ZnF_C2H2 732 754 4.8e-6 SMART
ZnF_C2H2 760 780 1.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205077
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fasl T A 1: 161,781,835 Y194F probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gen1 A G 12: 11,262,530 V13A possibly damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Lmf2 A T 15: 89,352,033 S588T probably benign Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Plekhf1 G A 7: 38,222,064 Q27* probably null Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Scube2 A G 7: 109,810,617 I557T probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in D3Ertd254e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:D3Ertd254e APN 3 36164580 missense possibly damaging 0.86
IGL02089:D3Ertd254e APN 3 36164728 missense possibly damaging 0.53
IGL02162:D3Ertd254e APN 3 36164061 missense probably benign 0.18
R0243:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R0512:D3Ertd254e UTSW 3 36166113 missense probably damaging 0.96
R0722:D3Ertd254e UTSW 3 36165069 missense probably benign 0.35
R0762:D3Ertd254e UTSW 3 36165867 missense possibly damaging 0.92
R0792:D3Ertd254e UTSW 3 36164562 missense probably benign 0.01
R0894:D3Ertd254e UTSW 3 36164786 nonsense probably null
R1731:D3Ertd254e UTSW 3 36164471 missense probably benign 0.18
R2098:D3Ertd254e UTSW 3 36166140 missense probably benign
R2099:D3Ertd254e UTSW 3 36164212 missense possibly damaging 0.86
R3709:D3Ertd254e UTSW 3 36159576 missense possibly damaging 0.71
R3808:D3Ertd254e UTSW 3 36165643 unclassified probably null
R4035:D3Ertd254e UTSW 3 36164840 missense possibly damaging 0.53
R4288:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4289:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4959:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R4973:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R5102:D3Ertd254e UTSW 3 36162665 missense possibly damaging 0.73
R5462:D3Ertd254e UTSW 3 36165820 missense possibly damaging 0.95
R5548:D3Ertd254e UTSW 3 36165491 missense possibly damaging 0.90
R5782:D3Ertd254e UTSW 3 36164979 missense possibly damaging 0.73
R6153:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R6225:D3Ertd254e UTSW 3 36166203 missense probably benign 0.18
R6602:D3Ertd254e UTSW 3 36164855 missense possibly damaging 0.86
R7513:D3Ertd254e UTSW 3 36164643 missense possibly damaging 0.53
R7846:D3Ertd254e UTSW 3 36165589 missense probably benign 0.43
R7929:D3Ertd254e UTSW 3 36165589 missense probably benign 0.43
X0021:D3Ertd254e UTSW 3 36164191 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGGCCCTACCATTGTAAAGA -3'
(R):5'- TTGTAGGGCTTCTCTCCAGTGT -3'

Sequencing Primer
(F):5'- GCCCTACCATTGTAAAGATTGCGG -3'
(R):5'- CTGGGTAAAAGCTTTGCCAC -3'
Posted On2018-08-29