Incidental Mutation 'R6785:Plekhf1'
ID531621
Institutional Source Beutler Lab
Gene Symbol Plekhf1
Ensembl Gene ENSMUSG00000074170
Gene Namepleckstrin homology domain containing, family F (with FYVE domain) member 1
SynonymsLAPF, 1810013P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6785 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location38216972-38228016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 38222064 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 27 (Q27*)
Ref Sequence ENSEMBL: ENSMUSP00000096113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098513]
Predicted Effect probably null
Transcript: ENSMUST00000098513
AA Change: Q27*
SMART Domains Protein: ENSMUSP00000096113
Gene: ENSMUSG00000074170
AA Change: Q27*

DomainStartEndE-ValueType
PH 36 133 9.05e-12 SMART
FYVE 144 213 1.52e-24 SMART
low complexity region 240 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
D3Ertd254e T A 3: 36,165,452 C541* probably null Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fasl T A 1: 161,781,835 Y194F probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gen1 A G 12: 11,262,530 V13A possibly damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Lmf2 A T 15: 89,352,033 S588T probably benign Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Scube2 A G 7: 109,810,617 I557T probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in Plekhf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Plekhf1 APN 7 38221797 missense probably benign
IGL01997:Plekhf1 APN 7 38221328 missense probably damaging 0.97
IGL03237:Plekhf1 APN 7 38221375 missense probably benign
R0671:Plekhf1 UTSW 7 38221402 missense probably benign 0.00
R1026:Plekhf1 UTSW 7 38221641 missense probably benign 0.10
R3085:Plekhf1 UTSW 7 38221577 missense probably benign
R4764:Plekhf1 UTSW 7 38221598 missense probably damaging 1.00
R5907:Plekhf1 UTSW 7 38222170 splice site probably null
R6291:Plekhf1 UTSW 7 38221605 missense possibly damaging 0.69
R7356:Plekhf1 UTSW 7 38222121 missense possibly damaging 0.67
R7601:Plekhf1 UTSW 7 38221880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTGGCTCCAATGTTAC -3'
(R):5'- CACAGTGCGATAATAGTTTGGTGG -3'

Sequencing Primer
(F):5'- CCTCTTCTAGGGGAATAATATGCTG -3'
(R):5'- CGATAATAGTTTGGTGGGTGAGTC -3'
Posted On2018-08-29