Incidental Mutation 'R6785:Scube2'
ID 531625
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock # R6785 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109810617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 557 (I557T)
Ref Sequence ENSEMBL: ENSMUSP00000102339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: I683T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: I683T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
AA Change: I557T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: I557T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
D3Ertd254e T A 3: 36,165,452 C541* probably null Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fasl T A 1: 161,781,835 Y194F probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gen1 A G 12: 11,262,530 V13A possibly damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Lmf2 A T 15: 89,352,033 S588T probably benign Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Plekhf1 G A 7: 38,222,064 Q27* probably null Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGTTCATGTAGGCATCAGC -3'
(R):5'- ACACTGACCAGATTGTCCCC -3'

Sequencing Primer
(F):5'- AGTGTGTCCGGTGCCAAC -3'
(R):5'- CCCTTTGGCTAGTCAGTTGCAG -3'
Posted On 2018-08-29