Incidental Mutation 'R6785:Lmf2'
ID531644
Institutional Source Beutler Lab
Gene Symbol Lmf2
Ensembl Gene ENSMUSG00000022614
Gene Namelipase maturation factor 2
SynonymsTmem153, Tmem112b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6785 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89351004-89355659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89352033 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 588 (S588T)
Ref Sequence ENSEMBL: ENSMUSP00000023283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023283] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000229111]
Predicted Effect probably benign
Transcript: ENSMUST00000023283
AA Change: S588T

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023283
Gene: ENSMUSG00000022614
AA Change: S588T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Pfam:LMF1 122 589 5.6e-164 PFAM
low complexity region 679 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229111
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 A G 2: 22,953,467 V316A probably benign Het
Acad12 T C 5: 121,609,845 Y170C probably damaging Het
Acss2 T C 2: 155,560,685 V587A probably damaging Het
Adamtsl3 A G 7: 82,522,004 I422V probably damaging Het
AI481877 T C 4: 59,049,066 M1100V probably benign Het
Aldh18a1 A G 19: 40,568,344 L375P probably damaging Het
B020011L13Rik A G 1: 117,801,069 D102G possibly damaging Het
Cfap74 T A 4: 155,454,024 probably benign Het
Coa4 G A 7: 100,539,253 V58M probably damaging Het
Crybg1 T C 10: 43,999,171 N647S probably benign Het
D3Ertd254e T A 3: 36,165,452 C541* probably null Het
Dync1h1 G A 12: 110,629,679 G1547S probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Fasl T A 1: 161,781,835 Y194F probably benign Het
Fbxw8 T C 5: 118,092,689 E349G probably damaging Het
Gen1 A G 12: 11,262,530 V13A possibly damaging Het
Gm4559 A G 7: 142,274,108 C86R unknown Het
H2-M9 T C 17: 36,642,233 N61D probably damaging Het
H6pd C T 4: 149,982,790 E380K possibly damaging Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hnrnpd C A 5: 99,978,424 K67N probably benign Het
Hspg2 T C 4: 137,508,398 S170P probably damaging Het
Igsf10 G T 3: 59,319,244 P2336Q probably damaging Het
Itih3 C T 14: 30,912,615 probably null Het
Katnb1 T C 8: 95,095,642 Y298H probably benign Het
Kif21a A T 15: 90,935,730 N1610K probably damaging Het
Lce1l A T 3: 92,850,193 C119* probably null Het
Lcn2 C T 2: 32,387,027 probably null Het
Mboat7 A G 7: 3,685,836 L231P probably benign Het
Mier2 T C 10: 79,544,713 R288G probably damaging Het
Mybbp1a T C 11: 72,447,566 V694A probably benign Het
Ndnf C A 6: 65,703,063 L109I probably benign Het
Nfkb1 C A 3: 135,615,303 E230D probably benign Het
Nostrin A G 2: 69,183,927 K409R probably benign Het
Olfr1082 T A 2: 86,594,421 M136L probably damaging Het
Olfr338 A G 2: 36,376,842 Q22R probably benign Het
Olfr338 C A 2: 36,376,951 Y58* probably null Het
Pdpr C A 8: 111,124,611 T534N probably benign Het
Plekhf1 G A 7: 38,222,064 Q27* probably null Het
Ppp6c A T 2: 39,197,581 H204Q probably benign Het
Prrc2c T C 1: 162,709,101 probably benign Het
Prrg2 A G 7: 45,060,225 F83L probably damaging Het
Rab11fip3 T G 17: 25,991,718 D938A probably damaging Het
Rai1 A G 11: 60,188,794 N1228S probably benign Het
Ryr1 G T 7: 29,064,874 T3060K probably benign Het
Scube2 A G 7: 109,810,617 I557T probably benign Het
Setdb1 C A 3: 95,326,401 R1066L probably benign Het
Slc35f3 T C 8: 126,394,459 V353A probably benign Het
Slfn3 A T 11: 83,214,601 T475S possibly damaging Het
Snrnp200 T A 2: 127,229,165 M1122K possibly damaging Het
Tead4 T A 6: 128,242,481 K223* probably null Het
Tex2 A C 11: 106,533,950 I334R probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Tfdp1 G T 8: 13,377,233 V393F possibly damaging Het
Thsd7b T C 1: 129,430,907 L26P probably damaging Het
Trim80 T C 11: 115,441,201 I73T probably damaging Het
Tssk4 T A 14: 55,650,475 Y43N probably damaging Het
Ttn T C 2: 76,711,495 T25389A probably damaging Het
Ttn A T 2: 76,747,944 F24202I probably damaging Het
Vmn1r177 A G 7: 23,866,137 S105P probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Other mutations in Lmf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Lmf2 APN 15 89353336 missense probably benign 0.00
IGL00953:Lmf2 APN 15 89353899 missense probably damaging 1.00
IGL00987:Lmf2 APN 15 89354568 missense probably benign
IGL01069:Lmf2 APN 15 89352888 missense probably benign 0.35
IGL01340:Lmf2 APN 15 89352872 missense probably damaging 0.98
IGL01878:Lmf2 APN 15 89352418 missense probably damaging 1.00
IGL02588:Lmf2 APN 15 89355406 unclassified probably null
IGL02698:Lmf2 APN 15 89354154 missense probably damaging 1.00
PIT4651001:Lmf2 UTSW 15 89352069 missense possibly damaging 0.58
R1761:Lmf2 UTSW 15 89352713 missense possibly damaging 0.61
R2355:Lmf2 UTSW 15 89351763 missense possibly damaging 0.65
R2880:Lmf2 UTSW 15 89351653 missense possibly damaging 0.59
R4896:Lmf2 UTSW 15 89351800 missense probably benign 0.16
R5141:Lmf2 UTSW 15 89351607 unclassified probably null
R7301:Lmf2 UTSW 15 89355530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGTCTGAGCTAGGCCATTG -3'
(R):5'- CAACTACCCCTTTCATGAACGG -3'

Sequencing Primer
(F):5'- AGCTAGGCCATTGCTGGG -3'
(R):5'- TTTCATGAACGGCCACCC -3'
Posted On2018-08-29