Incidental Mutation 'R6794:Sapcd2'
ID531653
Institutional Source Beutler Lab
Gene Symbol Sapcd2
Ensembl Gene ENSMUSG00000026955
Gene Namesuppressor APC domain containing 2
Synonyms6030458L21Rik, ang, 2010317E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6794 (G1)
Quality Score166.009
Status Validated
Chromosome2
Chromosomal Location25372321-25378213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25376367 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 389 (S389G)
Ref Sequence ENSEMBL: ENSMUSP00000028329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028329] [ENSMUST00000100323] [ENSMUST00000114293]
Predicted Effect probably damaging
Transcript: ENSMUST00000028329
AA Change: S389G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028329
Gene: ENSMUSG00000026955
AA Change: S389G

DomainStartEndE-ValueType
low complexity region 197 212 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
Pfam:Suppressor_APC 257 340 1.6e-34 PFAM
low complexity region 348 362 N/A INTRINSIC
coiled coil region 374 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100323
AA Change: S410G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097898
Gene: ENSMUSG00000026955
AA Change: S410G

DomainStartEndE-ValueType
low complexity region 202 216 N/A INTRINSIC
Pfam:Suppressor_APC 224 305 2.2e-32 PFAM
low complexity region 385 392 N/A INTRINSIC
coiled coil region 403 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114293
AA Change: S355G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109932
Gene: ENSMUSG00000026955
AA Change: S355G

DomainStartEndE-ValueType
low complexity region 202 216 N/A INTRINSIC
Pfam:Suppressor_APC 223 306 1.4e-34 PFAM
low complexity region 314 328 N/A INTRINSIC
coiled coil region 340 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Herpud1 T A 8: 94,394,770 probably null Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Sapcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Sapcd2 APN 2 25376479 makesense probably null
R1596:Sapcd2 UTSW 2 25376410 missense probably damaging 1.00
R3815:Sapcd2 UTSW 2 25373506 intron probably benign
R4826:Sapcd2 UTSW 2 25372756 missense probably benign 0.09
R4926:Sapcd2 UTSW 2 25373566 splice site probably null
R6442:Sapcd2 UTSW 2 25376122 intron probably benign
R7090:Sapcd2 UTSW 2 25376079 missense probably benign 0.00
R7659:Sapcd2 UTSW 2 25375966 critical splice acceptor site probably null
R7744:Sapcd2 UTSW 2 25373496 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTCTGGCTCACTGTGTACTTC -3'
(R):5'- GCAGTGTCATGGAGCTGAAG -3'

Sequencing Primer
(F):5'- GTGTACTTCCACAGGCTCTG -3'
(R):5'- CTGAAGCTAAGTCTGTGTGCAC -3'
Posted On2018-08-29