Incidental Mutation 'R6794:Prim1'
ID531675
Institutional Source Beutler Lab
Gene Symbol Prim1
Ensembl Gene ENSMUSG00000025395
Gene NameDNA primase, p49 subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6794 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128015168-128030037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128018149 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000136556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026461] [ENSMUST00000178041]
Predicted Effect probably damaging
Transcript: ENSMUST00000026461
AA Change: S124P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026461
Gene: ENSMUSG00000025395
AA Change: S124P

DomainStartEndE-ValueType
Pfam:DNA_primase_S 108 336 9.7e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178041
AA Change: S124P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136556
Gene: ENSMUSG00000025395
AA Change: S124P

DomainStartEndE-ValueType
Pfam:DNA_primase_S 108 336 3.3e-71 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The replication of DNA in eukaryotic cells is carried out by a complex chromosomal replication apparatus, in which DNA polymerase alpha and primase are two key enzymatic components. Primase, which is a heterodimer of a small subunit and a large subunit, synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication. The protein encoded by this gene is the small, 49 kDa primase subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Herpud1 T A 8: 94,394,770 probably null Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Prim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Prim1 APN 10 128029243 missense probably benign
IGL01896:Prim1 APN 10 128022889 missense probably damaging 1.00
IGL02505:Prim1 APN 10 128029783 makesense probably null
PIT4403001:Prim1 UTSW 10 128022876 missense probably benign 0.01
R0563:Prim1 UTSW 10 128026554 missense probably damaging 1.00
R1732:Prim1 UTSW 10 128015324 missense probably damaging 1.00
R1976:Prim1 UTSW 10 128023799 missense probably benign
R2263:Prim1 UTSW 10 128015263 missense probably benign 0.13
R4774:Prim1 UTSW 10 128027018 intron probably benign
R4976:Prim1 UTSW 10 128015262 missense probably damaging 0.97
R5908:Prim1 UTSW 10 128018024 missense probably damaging 1.00
R6356:Prim1 UTSW 10 128023835 missense probably damaging 0.97
R6598:Prim1 UTSW 10 128020180 missense possibly damaging 0.83
R7179:Prim1 UTSW 10 128015976 missense probably damaging 1.00
R7325:Prim1 UTSW 10 128022919 missense probably null 0.13
R7432:Prim1 UTSW 10 128016016 missense probably damaging 1.00
R7542:Prim1 UTSW 10 128018034 missense probably damaging 1.00
R7659:Prim1 UTSW 10 128026589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTATTCTTAGCCCAATCAACACAAT -3'
(R):5'- TGAAATACAGAGACTGAGAGCAT -3'

Sequencing Primer
(F):5'- TTAGCCCAATCAACACAATACAGTG -3'
(R):5'- TATTGACATACGGAGACACACC -3'
Posted On2018-08-29