Incidental Mutation 'R6794:Atf7'
ID531679
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Nameactivating transcription factor 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6794 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102525946-102625464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102557465 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 87 (K87E)
Ref Sequence ENSEMBL: ENSMUSP00000139054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108828] [ENSMUST00000169033] [ENSMUST00000183452] [ENSMUST00000183765] [ENSMUST00000184077] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906] [ENSMUST00000185070]
Predicted Effect probably benign
Transcript: ENSMUST00000108828
AA Change: K87E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104456
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169033
AA Change: K87E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130130
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183452
SMART Domains Protein: ENSMUSP00000139367
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183765
AA Change: K87E

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139054
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184077
SMART Domains Protein: ENSMUSP00000139217
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184485
AA Change: K87E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184616
AA Change: K87E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184772
AA Change: K87E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184906
AA Change: K87E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083
AA Change: K87E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185070
SMART Domains Protein: ENSMUSP00000139379
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Herpud1 T A 8: 94,394,770 probably null Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102551478 nonsense probably null
R2183:Atf7 UTSW 15 102546473 missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102529004 intron probably benign
R3114:Atf7 UTSW 15 102534423 missense probably benign 0.10
R3115:Atf7 UTSW 15 102534423 missense probably benign 0.10
R4544:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4545:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4546:Atf7 UTSW 15 102534327 missense probably benign 0.08
R5148:Atf7 UTSW 15 102547173 missense probably benign 0.02
R5568:Atf7 UTSW 15 102563322 missense probably damaging 0.99
R5688:Atf7 UTSW 15 102551509 missense probably damaging 1.00
R5805:Atf7 UTSW 15 102557587 splice site probably null
R6021:Atf7 UTSW 15 102557473 missense probably benign 0.20
R6259:Atf7 UTSW 15 102547238 missense probably damaging 1.00
R6347:Atf7 UTSW 15 102546479 missense possibly damaging 0.91
R6476:Atf7 UTSW 15 102593712 missense probably benign 0.13
R7104:Atf7 UTSW 15 102534235 missense probably benign 0.40
R7369:Atf7 UTSW 15 102553809 missense probably damaging 0.98
R8111:Atf7 UTSW 15 102563334 missense probably damaging 0.96
R8244:Atf7 UTSW 15 102528866 missense unknown
X0027:Atf7 UTSW 15 102593670 critical splice donor site probably null
Z1088:Atf7 UTSW 15 102547182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTGGTCCACCAACTAGAAC -3'
(R):5'- AATACAATCCCTGTGCACTCTC -3'

Sequencing Primer
(F):5'- AAGATGTGGCACATGCTTGTCATC -3'
(R):5'- CCCTGTGCACTCTCAAATTTTAATC -3'
Posted On2018-08-29