Incidental Mutation 'R6794:Vmn2r118'
ID531683
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Namevomeronasal 2, receptor 118
SynonymsEG383258, Vmn2r119, EG668547
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6794 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55592341-55624672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55592348 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 852 (H852L)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168440
AA Change: H852L

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: H852L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Herpud1 T A 8: 94,394,770 probably null Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Shf A G 2: 122,353,840 L234P probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55624494 missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55592996 missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55592714 missense possibly damaging 0.92
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55610423 missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55608057 missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55608642 missense probably benign 0.33
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAGGATCTACCCAGAAGCAAATC -3'
(R):5'- AGTGTTTGGGTCACCTTCC -3'

Sequencing Primer
(F):5'- TTAACATAAAATGTGGG -3'
(R):5'- GGGTCACCTTCCTCCCTG -3'
Posted On2018-08-29