Mutagenetix > Incidental Mutations

Incidental Mutation 'R6794:Vmn2r118'

531683

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R6794 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55592348 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 852 (H852L)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168440
AA Change: H852L

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: H852L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.4%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	G	1: 37,637,855		probably null	Het
Agxt	T	C	1: 93,135,382	V30A	possibly damaging	Het
Atf7	T	C	15: 102,557,465	K87E	probably benign	Het
Btg4	A	C	9: 51,119,351	K250N	possibly damaging	Het
Cyc1	A	G	15: 76,344,650	Y132C	probably damaging	Het
Dcaf5	A	T	12: 80,398,893	D137E	possibly damaging	Het
Ddr2	C	A	1: 169,982,098	W770L	probably damaging	Het
Disc1	T	C	8: 125,087,775	V126A	probably benign	Het
Dock8	A	G	19: 25,122,441	N643D	probably benign	Het
Gabrg1	C	T	5: 70,815,971	R75H	probably damaging	Het
Gm14418	A	T	2: 177,387,838	H121Q	probably damaging	Het
H2-Ob	T	A	17: 34,241,188	L20Q	possibly damaging	Het
Herpud1	T	A	8: 94,394,770		probably null	Het
Ica1	T	C	6: 8,653,659	D326G	probably benign	Het
Jph3	T	C	8: 121,785,385	L704P	probably benign	Het
Kmt2e	TGCCGCCGCCGCCGCCACCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC	5: 23,499,476		probably benign	Het
Lnpep	T	G	17: 17,531,159	N948T	probably damaging	Het
Mdn1	T	A	4: 32,741,893	V3888D	probably damaging	Het
Muc5ac	T	C	7: 141,809,552		probably benign	Het
Nfkb2	T	C	19: 46,307,720		probably null	Het
Pik3r2	T	C	8: 70,770,717	H380R	probably benign	Het
Prim1	T	C	10: 128,018,149	S124P	probably damaging	Het
Prokr1	T	C	6: 87,588,693	T57A	possibly damaging	Het
Ptpn4	T	C	1: 119,743,390	T213A	probably damaging	Het
Sapcd2	A	G	2: 25,376,367	S389G	probably damaging	Het
Scn5a	T	C	9: 119,535,889	Q421R	probably damaging	Het
Serac1	A	G	17: 6,051,710	Y430H	probably damaging	Het
Shf	A	G	2: 122,353,840	L234P	probably damaging	Het
Slc22a29	G	T	19: 8,161,523	S525Y	probably benign	Het
Thbs1	A	G	2: 118,120,038		probably null	Het
Tln2	T	C	9: 67,286,558	D666G	probably benign	Het
Ubqlnl	C	T	7: 104,148,785	E502K	probably benign	Het
Uhrf1bp1l	T	C	10: 89,805,762	S932P	probably benign	Het
Vmn2r72	A	G	7: 85,737,996	F787L	probably damaging	Het
Xpc	G	A	6: 91,506,857	A169V	probably benign	Het
Ylpm1	A	G	12: 84,996,881	H131R	unknown	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTAGGATCTACCCAGAAGCAAATC -3'
(R):5'- AGTGTTTGGGTCACCTTCC -3'

Sequencing Primer
(F):5'- TTAACATAAAATGTGGG -3'
(R):5'- GGGTCACCTTCCTCCCTG -3'

Posted On

2018-08-29