Incidental Mutation 'R6794:Dock8'
ID 531685
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 044907-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6794 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25099805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 643 (N643D)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: N643D

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: N643D

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.1469 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt T C 1: 93,063,104 (GRCm39) V30A possibly damaging Het
Atf7 T C 15: 102,465,900 (GRCm39) K87E probably benign Het
Bltp3b T C 10: 89,641,624 (GRCm39) S932P probably benign Het
Btg4 A C 9: 51,030,651 (GRCm39) K250N possibly damaging Het
Cracdl A G 1: 37,676,936 (GRCm39) probably null Het
Cyc1 A G 15: 76,228,850 (GRCm39) Y132C probably damaging Het
Dcaf5 A T 12: 80,445,667 (GRCm39) D137E possibly damaging Het
Ddr2 C A 1: 169,809,667 (GRCm39) W770L probably damaging Het
Disc1 T C 8: 125,814,514 (GRCm39) V126A probably benign Het
Gabrg1 C T 5: 70,973,314 (GRCm39) R75H probably damaging Het
Gm14418 A T 2: 177,079,631 (GRCm39) H121Q probably damaging Het
H2-Ob T A 17: 34,460,162 (GRCm39) L20Q possibly damaging Het
Herpud1 T A 8: 95,121,398 (GRCm39) probably null Het
Ica1 T C 6: 8,653,659 (GRCm39) D326G probably benign Het
Jph3 T C 8: 122,512,124 (GRCm39) L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,704,474 (GRCm39) probably benign Het
Lnpep T G 17: 17,751,421 (GRCm39) N948T probably damaging Het
Mdn1 T A 4: 32,741,893 (GRCm39) V3888D probably damaging Het
Muc5ac T C 7: 141,363,289 (GRCm39) probably benign Het
Nfkb2 T C 19: 46,296,159 (GRCm39) probably null Het
Pik3r2 T C 8: 71,223,361 (GRCm39) H380R probably benign Het
Prim1 T C 10: 127,854,018 (GRCm39) S124P probably damaging Het
Prokr1 T C 6: 87,565,675 (GRCm39) T57A possibly damaging Het
Ptpn4 T C 1: 119,671,120 (GRCm39) T213A probably damaging Het
Sapcd2 A G 2: 25,266,379 (GRCm39) S389G probably damaging Het
Scn5a T C 9: 119,364,955 (GRCm39) Q421R probably damaging Het
Serac1 A G 17: 6,101,985 (GRCm39) Y430H probably damaging Het
Shf A G 2: 122,184,321 (GRCm39) L234P probably damaging Het
Slc22a29 G T 19: 8,138,887 (GRCm39) S525Y probably benign Het
Thbs1 A G 2: 117,950,519 (GRCm39) probably null Het
Tln2 T C 9: 67,193,840 (GRCm39) D666G probably benign Het
Ubqlnl C T 7: 103,797,992 (GRCm39) E502K probably benign Het
Vmn2r118 T A 17: 55,899,348 (GRCm39) H852L possibly damaging Het
Vmn2r72 A G 7: 85,387,204 (GRCm39) F787L probably damaging Het
Xpc G A 6: 91,483,839 (GRCm39) A169V probably benign Het
Ylpm1 A G 12: 85,043,655 (GRCm39) H131R unknown Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAGCATGCAAGGCACATG -3'
(R):5'- CTGGCACTCTCTAGGTAAAGC -3'

Sequencing Primer
(F):5'- CATGCAAGGCACATGGGAGC -3'
(R):5'- ATGCACCACGTATTTGGCAG -3'
Posted On 2018-08-29