Incidental Mutation 'R6761:Hltf'
ID 531690
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms Snf2l3, Smarca3, P113
MMRRC Submission 044877-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6761 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 20111975-20172654 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 20137996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably null
Transcript: ENSMUST00000002502
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,845 (GRCm39) V61A probably benign Het
Actr3b C T 5: 26,030,137 (GRCm39) S67F probably damaging Het
Ap3m1 T C 14: 21,088,096 (GRCm39) M107V probably benign Het
Ccdc27 C T 4: 154,122,155 (GRCm39) G241D unknown Het
Cit T G 5: 116,046,734 (GRCm39) D382E probably damaging Het
Clec3b G T 9: 122,986,004 (GRCm39) G134V probably damaging Het
Cntnap2 T A 6: 47,026,307 (GRCm39) H44Q probably benign Het
Dst T C 1: 34,253,631 (GRCm39) S4300P probably damaging Het
Ebna1bp2 C T 4: 118,480,558 (GRCm39) R134* probably null Het
Efcab14 T C 4: 115,596,024 (GRCm39) S57P probably damaging Het
Exosc2 T C 2: 31,560,875 (GRCm39) probably null Het
Hfm1 T C 5: 107,043,145 (GRCm39) T630A probably damaging Het
Hkdc1 A T 10: 62,244,477 (GRCm39) I203N possibly damaging Het
Igkv3-2 G T 6: 70,675,501 (GRCm39) probably benign Het
Mslnl A G 17: 25,965,047 (GRCm39) D471G probably damaging Het
Msmo1 A G 8: 65,172,061 (GRCm39) Y281H probably benign Het
Nid1 A G 13: 13,656,620 (GRCm39) T584A probably benign Het
Olfr908 A G 9: 38,427,561 (GRCm39) T78A probably damaging Het
Or52a24 C T 7: 103,381,691 (GRCm39) A186V probably damaging Het
Otoa G A 7: 120,721,173 (GRCm39) G396D probably damaging Het
Prss45 G T 9: 110,669,487 (GRCm39) A197S probably damaging Het
Prxl2a T A 14: 40,716,578 (GRCm39) H198L probably damaging Het
Rpap2 T A 5: 107,768,104 (GRCm39) I314N probably benign Het
Sash1 A G 10: 8,620,286 (GRCm39) M458T probably damaging Het
Slc44a5 A G 3: 153,945,714 (GRCm39) probably null Het
Sorbs2 T C 8: 46,225,651 (GRCm39) S254P probably damaging Het
Sycp2 T C 2: 178,016,144 (GRCm39) probably null Het
Tedc1 A G 12: 113,125,334 (GRCm39) D252G probably damaging Het
Uty T C Y: 1,186,790 (GRCm39) H145R probably damaging Homo
Vmn1r9 A G 6: 57,048,291 (GRCm39) Y122C probably benign Het
Wdfy4 T A 14: 32,817,908 (GRCm39) N1491Y possibly damaging Het
Wdr37 T C 13: 8,899,684 (GRCm39) T140A probably benign Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20,159,796 (GRCm39) splice site probably benign
IGL01461:Hltf APN 3 20,154,103 (GRCm39) nonsense probably null
IGL01630:Hltf APN 3 20,137,068 (GRCm39) splice site probably benign
IGL01704:Hltf APN 3 20,137,910 (GRCm39) splice site probably benign
IGL02059:Hltf APN 3 20,160,621 (GRCm39) missense probably benign
IGL02105:Hltf APN 3 20,146,921 (GRCm39) missense probably damaging 1.00
IGL02156:Hltf APN 3 20,146,971 (GRCm39) missense possibly damaging 0.61
IGL02870:Hltf APN 3 20,154,037 (GRCm39) missense probably damaging 0.98
IGL02899:Hltf APN 3 20,153,981 (GRCm39) missense probably damaging 1.00
IGL02935:Hltf APN 3 20,123,215 (GRCm39) missense probably damaging 1.00
IGL02950:Hltf APN 3 20,130,736 (GRCm39) missense probably benign 0.07
IGL03082:Hltf APN 3 20,118,723 (GRCm39) splice site probably benign
snarky UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R0068:Hltf UTSW 3 20,113,254 (GRCm39) missense probably damaging 1.00
R0787:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R0905:Hltf UTSW 3 20,163,033 (GRCm39) critical splice donor site probably null
R0980:Hltf UTSW 3 20,145,665 (GRCm39) missense probably benign 0.00
R1741:Hltf UTSW 3 20,140,352 (GRCm39) missense probably damaging 1.00
R1748:Hltf UTSW 3 20,130,685 (GRCm39) missense probably benign 0.13
R1799:Hltf UTSW 3 20,159,855 (GRCm39) missense probably damaging 1.00
R1976:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R2171:Hltf UTSW 3 20,113,245 (GRCm39) missense probably damaging 1.00
R2395:Hltf UTSW 3 20,146,906 (GRCm39) missense probably benign 0.41
R2444:Hltf UTSW 3 20,118,071 (GRCm39) missense possibly damaging 0.66
R3789:Hltf UTSW 3 20,123,211 (GRCm39) missense probably damaging 1.00
R3943:Hltf UTSW 3 20,146,908 (GRCm39) missense probably damaging 1.00
R4719:Hltf UTSW 3 20,118,865 (GRCm39) critical splice donor site probably null
R4793:Hltf UTSW 3 20,118,114 (GRCm39) missense possibly damaging 0.79
R5296:Hltf UTSW 3 20,162,276 (GRCm39) missense probably damaging 0.99
R5449:Hltf UTSW 3 20,123,247 (GRCm39) missense possibly damaging 0.92
R5492:Hltf UTSW 3 20,152,231 (GRCm39) splice site probably null
R6012:Hltf UTSW 3 20,113,098 (GRCm39) missense probably damaging 1.00
R6157:Hltf UTSW 3 20,130,660 (GRCm39) missense probably benign 0.13
R6254:Hltf UTSW 3 20,117,993 (GRCm39) missense possibly damaging 0.85
R6553:Hltf UTSW 3 20,126,558 (GRCm39) missense probably damaging 0.96
R6616:Hltf UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R6696:Hltf UTSW 3 20,119,470 (GRCm39) splice site probably null
R6781:Hltf UTSW 3 20,152,330 (GRCm39) missense probably benign 0.00
R7241:Hltf UTSW 3 20,119,556 (GRCm39) missense probably benign 0.07
R7356:Hltf UTSW 3 20,163,534 (GRCm39) missense probably damaging 1.00
R7453:Hltf UTSW 3 20,136,916 (GRCm39) missense possibly damaging 0.81
R7765:Hltf UTSW 3 20,145,647 (GRCm39) missense probably benign 0.02
R7978:Hltf UTSW 3 20,146,968 (GRCm39) missense probably damaging 1.00
R8299:Hltf UTSW 3 20,136,986 (GRCm39) missense possibly damaging 0.73
R8547:Hltf UTSW 3 20,152,291 (GRCm39) missense probably damaging 1.00
R8857:Hltf UTSW 3 20,159,825 (GRCm39) missense probably damaging 0.98
R8859:Hltf UTSW 3 20,119,566 (GRCm39) nonsense probably null
R8926:Hltf UTSW 3 20,123,323 (GRCm39) critical splice donor site probably null
R8959:Hltf UTSW 3 20,136,936 (GRCm39) missense probably damaging 1.00
R9052:Hltf UTSW 3 20,152,246 (GRCm39) missense probably damaging 1.00
R9214:Hltf UTSW 3 20,140,280 (GRCm39) missense probably benign 0.01
R9405:Hltf UTSW 3 20,137,094 (GRCm39) missense possibly damaging 0.88
R9565:Hltf UTSW 3 20,136,996 (GRCm39) critical splice donor site probably null
X0027:Hltf UTSW 3 20,121,553 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCATAAGTGCCAATGTTGTTTACC -3'
(R):5'- GGCATGGAGAAAGCTACACC -3'

Sequencing Primer
(F):5'- TTCCTAAGGAGGCACAGT -3'
(R):5'- TGCTGTTCATCACCAAAGGAAGTC -3'
Posted On 2018-08-29