Incidental Mutation 'R6761:Rpap2'
ID531696
Institutional Source Beutler Lab
Gene Symbol Rpap2
Ensembl Gene ENSMUSG00000033773
Gene NameRNA polymerase II associated protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107597373-107661838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107620238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 314 (I314N)
Ref Sequence ENSEMBL: ENSMUSP00000108274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065422] [ENSMUST00000112650] [ENSMUST00000112651] [ENSMUST00000112654] [ENSMUST00000112655]
Predicted Effect probably benign
Transcript: ENSMUST00000065422
AA Change: I314N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070209
Gene: ENSMUSG00000033773
AA Change: I314N

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 80 152 3.6e-26 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112650
AA Change: I235N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108269
Gene: ENSMUSG00000033773
AA Change: I235N

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 74 1.7e-28 PFAM
low complexity region 129 142 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112651
AA Change: I237N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108270
Gene: ENSMUSG00000033773
AA Change: I237N

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 1 76 1.9e-28 PFAM
low complexity region 131 144 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 482 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112654
AA Change: I314N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108273
Gene: ENSMUSG00000033773
AA Change: I314N

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 1.8e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112655
AA Change: I314N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108274
Gene: ENSMUSG00000033773
AA Change: I314N

DomainStartEndE-ValueType
Pfam:RPAP2_Rtr1 78 153 4.1e-28 PFAM
low complexity region 208 221 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Rpap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rpap2 APN 5 107603631 unclassified probably benign
IGL01451:Rpap2 APN 5 107603626 critical splice donor site probably null
IGL01583:Rpap2 APN 5 107620195 missense probably damaging 0.99
IGL01837:Rpap2 APN 5 107625969 critical splice donor site probably null
IGL02343:Rpap2 APN 5 107618181 splice site probably null
IGL02999:Rpap2 APN 5 107601831 missense possibly damaging 0.61
IGL03261:Rpap2 APN 5 107598560 missense possibly damaging 0.95
IGL03381:Rpap2 APN 5 107620201 missense probably benign 0.00
R0077:Rpap2 UTSW 5 107620474 missense probably damaging 1.00
R1698:Rpap2 UTSW 5 107603550 missense probably damaging 1.00
R1897:Rpap2 UTSW 5 107633095 missense possibly damaging 0.85
R3039:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R3605:Rpap2 UTSW 5 107620529 missense probably damaging 1.00
R3735:Rpap2 UTSW 5 107655151 splice site probably benign
R4007:Rpap2 UTSW 5 107603872 missense probably damaging 1.00
R4367:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4448:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4589:Rpap2 UTSW 5 107620495 missense probably benign 0.00
R4606:Rpap2 UTSW 5 107601795 missense possibly damaging 0.95
R4799:Rpap2 UTSW 5 107620247 missense probably benign 0.00
R4939:Rpap2 UTSW 5 107603625 critical splice donor site probably null
R5580:Rpap2 UTSW 5 107620145 missense probably benign 0.12
R6003:Rpap2 UTSW 5 107601901 unclassified probably null
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6032:Rpap2 UTSW 5 107597795 missense probably damaging 0.97
R6142:Rpap2 UTSW 5 107598298 missense probably benign
R6161:Rpap2 UTSW 5 107620670 missense probably damaging 1.00
R6687:Rpap2 UTSW 5 107603630 splice site probably null
R6783:Rpap2 UTSW 5 107655287 missense probably damaging 0.99
R7106:Rpap2 UTSW 5 107633122 nonsense probably null
R7314:Rpap2 UTSW 5 107620379 missense probably damaging 0.96
R7402:Rpap2 UTSW 5 107620458 nonsense probably null
R7644:Rpap2 UTSW 5 107620301 missense probably benign 0.04
R7782:Rpap2 UTSW 5 107620192 missense probably benign 0.08
R7890:Rpap2 UTSW 5 107606911 missense probably damaging 1.00
R7973:Rpap2 UTSW 5 107606911 missense probably damaging 1.00
R8010:Rpap2 UTSW 5 107603605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAACGTGGACTCCAAG -3'
(R):5'- ACAGAATCGTGGTTCTGGC -3'

Sequencing Primer
(F):5'- CGTGGACTCCAAGGAGGG -3'
(R):5'- CATTCAGTCAGAGTGTCCGACAG -3'
Posted On2018-08-29