Incidental Mutation 'R6761:Cntnap2'
ID 531698
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission 044877-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6761 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47049373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 44 (H44Q)
Ref Sequence ENSEMBL: ENSMUSP00000142656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: H985Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: H985Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150737
AA Change: H44Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: H44Q

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 (GRCm38) V61A probably benign Het
Actr3b C T 5: 25,825,139 (GRCm38) S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 (GRCm38) M107V probably benign Het
Ccdc27 C T 4: 154,037,698 (GRCm38) G241D unknown Het
Cit T G 5: 115,908,675 (GRCm38) D382E probably damaging Het
Clec3b G T 9: 123,156,939 (GRCm38) G134V probably damaging Het
Dst T C 1: 34,214,550 (GRCm38) S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 (GRCm38) R134* probably null Het
Efcab14 T C 4: 115,738,827 (GRCm38) S57P probably damaging Het
Exosc2 T C 2: 31,670,863 (GRCm38) probably null Het
Hfm1 T C 5: 106,895,279 (GRCm38) T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 (GRCm38) I203N possibly damaging Het
Hltf T A 3: 20,083,832 (GRCm38) probably null Het
Igkv3-2 G T 6: 70,698,517 (GRCm38) probably benign Het
Mslnl A G 17: 25,746,073 (GRCm38) D471G probably damaging Het
Msmo1 A G 8: 64,719,027 (GRCm38) Y281H probably benign Het
Nid1 A G 13: 13,482,035 (GRCm38) T584A probably benign Het
Olfr908 A G 9: 38,516,265 (GRCm38) T78A probably damaging Het
Or52a24 C T 7: 103,732,484 (GRCm38) A186V probably damaging Het
Otoa G A 7: 121,121,950 (GRCm38) G396D probably damaging Het
Prss45 G T 9: 110,840,419 (GRCm38) A197S probably damaging Het
Prxl2a T A 14: 40,994,621 (GRCm38) H198L probably damaging Het
Rpap2 T A 5: 107,620,238 (GRCm38) I314N probably benign Het
Sash1 A G 10: 8,744,522 (GRCm38) M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 (GRCm38) probably null Het
Sorbs2 T C 8: 45,772,614 (GRCm38) S254P probably damaging Het
Sycp2 T C 2: 178,374,351 (GRCm38) probably null Het
Tedc1 A G 12: 113,161,714 (GRCm38) D252G probably damaging Het
Uty T C Y: 1,186,790 (GRCm38) H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 (GRCm38) Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 (GRCm38) N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 (GRCm38) T140A probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46,015,263 (GRCm38) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,988,787 (GRCm38) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,193,038 (GRCm38) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,484,072 (GRCm38) missense probably benign
IGL00857:Cntnap2 APN 6 47,049,424 (GRCm38) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46,015,465 (GRCm38) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,193,013 (GRCm38) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,271,371 (GRCm38) nonsense probably null
IGL01859:Cntnap2 APN 6 46,988,721 (GRCm38) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,234,203 (GRCm38) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47,021,654 (GRCm38) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,234,320 (GRCm38) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47,021,736 (GRCm38) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,095,549 (GRCm38) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,170,245 (GRCm38) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,530,171 (GRCm38) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,992,073 (GRCm38) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,992,073 (GRCm38) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,483,983 (GRCm38) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,060,392 (GRCm38) splice site probably null
R0352:Cntnap2 UTSW 6 45,992,084 (GRCm38) splice site probably null
R0389:Cntnap2 UTSW 6 46,009,637 (GRCm38) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,715,816 (GRCm38) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,529,905 (GRCm38) nonsense probably null
R0611:Cntnap2 UTSW 6 47,095,549 (GRCm38) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,988,760 (GRCm38) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,296,708 (GRCm38) splice site probably benign
R0976:Cntnap2 UTSW 6 47,271,230 (GRCm38) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1387:Cntnap2 UTSW 6 47,107,914 (GRCm38) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,530,679 (GRCm38) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46,015,330 (GRCm38) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,107,892 (GRCm38) nonsense probably null
R1757:Cntnap2 UTSW 6 46,759,829 (GRCm38) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,988,675 (GRCm38) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,530,633 (GRCm38) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,298,588 (GRCm38) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,298,445 (GRCm38) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46,015,266 (GRCm38) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,991,903 (GRCm38) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,856,128 (GRCm38) missense probably benign
R4030:Cntnap2 UTSW 6 46,856,128 (GRCm38) missense probably benign
R4237:Cntnap2 UTSW 6 46,530,390 (GRCm38) intron probably benign
R4445:Cntnap2 UTSW 6 46,759,851 (GRCm38) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,060,317 (GRCm38) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,060,317 (GRCm38) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,530,035 (GRCm38) intron probably benign
R4918:Cntnap2 UTSW 6 46,530,035 (GRCm38) intron probably benign
R4999:Cntnap2 UTSW 6 45,920,834 (GRCm38) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,107,969 (GRCm38) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,107,969 (GRCm38) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,920,926 (GRCm38) nonsense probably null
R5748:Cntnap2 UTSW 6 45,715,884 (GRCm38) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,529,815 (GRCm38) intron probably benign
R6118:Cntnap2 UTSW 6 47,193,077 (GRCm38) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,759,808 (GRCm38) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,271,298 (GRCm38) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,060,112 (GRCm38) splice site probably null
R6385:Cntnap2 UTSW 6 46,856,180 (GRCm38) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,759,760 (GRCm38) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,170,272 (GRCm38) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46,015,257 (GRCm38) missense probably benign 0.08
R7125:Cntnap2 UTSW 6 46,988,646 (GRCm38) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,271,271 (GRCm38) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,484,029 (GRCm38) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,347,145 (GRCm38) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,095,693 (GRCm38) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,049,373 (GRCm38) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,759,773 (GRCm38) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,992,041 (GRCm38) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,049,222 (GRCm38) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46,001,227 (GRCm38) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,856,142 (GRCm38) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,484,049 (GRCm38) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,484,205 (GRCm38) intron probably benign
R9209:Cntnap2 UTSW 6 47,049,249 (GRCm38) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46,001,178 (GRCm38) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46,001,347 (GRCm38) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46,001,310 (GRCm38) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,234,283 (GRCm38) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46,015,231 (GRCm38) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,992,075 (GRCm38) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,988,792 (GRCm38) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46,015,439 (GRCm38) frame shift probably null
R9745:Cntnap2 UTSW 6 46,234,166 (GRCm38) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,049,327 (GRCm38) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47,021,665 (GRCm38) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46,009,518 (GRCm38) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47,021,754 (GRCm38) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,234,245 (GRCm38) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,271,148 (GRCm38) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46,015,299 (GRCm38) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGCCCTTTGAACTCTGTGC -3'
(R):5'- GGTAGGAGAGGAGTTCACTCTACC -3'

Sequencing Primer
(F):5'- CTGTCATTCCCAGGTGGTGC -3'
(R):5'- GAGAGGAGTTCACTCTACCCTTAG -3'
Posted On 2018-08-29