Incidental Mutation 'R6761:Sash1'
ID531709
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8744522 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 458 (M458T)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449] [ENSMUST00000212869]
Predicted Effect probably damaging
Transcript: ENSMUST00000015449
AA Change: M458T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: M458T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212869
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCCAGCACTGAGAACACTG -3'
(R):5'- AGTAATGGAACTGGTTTGTAGCC -3'

Sequencing Primer
(F):5'- AGCCCTGACTGCTTAATGAG -3'
(R):5'- AGCCTTATCTCCTAGGAGTAATGGC -3'
Posted On2018-08-29