Incidental Mutation 'R6761:Wdr37'
ID531712
Institutional Source Beutler Lab
Gene Symbol Wdr37
Ensembl Gene ENSMUSG00000021147
Gene NameWD repeat domain 37
Synonyms3110035P10Rik, 4933417A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location8802968-8871909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8849648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 140 (T140A)
Ref Sequence ENSEMBL: ENSMUSP00000135097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021572] [ENSMUST00000054251] [ENSMUST00000164183] [ENSMUST00000176098] [ENSMUST00000176329] [ENSMUST00000176587] [ENSMUST00000176715] [ENSMUST00000176813] [ENSMUST00000176922]
Predicted Effect probably benign
Transcript: ENSMUST00000021572
AA Change: T140A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021572
Gene: ENSMUSG00000021147
AA Change: T140A

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054251
AA Change: T140A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062174
Gene: ENSMUSG00000021147
AA Change: T140A

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
WD40 145 185 9.75e-3 SMART
WD40 188 227 4.27e-8 SMART
WD40 272 311 1.06e-3 SMART
WD40 314 353 4.91e-8 SMART
WD40 358 396 2.38e-6 SMART
Blast:WD40 400 438 8e-17 BLAST
WD40 445 486 6.19e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164183
SMART Domains Protein: ENSMUSP00000131469
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176098
SMART Domains Protein: ENSMUSP00000135094
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
WD40 19 58 4.27e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176329
AA Change: T95A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135101
Gene: ENSMUSG00000021147
AA Change: T95A

DomainStartEndE-ValueType
WD40 100 140 9.75e-3 SMART
WD40 143 182 4.27e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176429
AA Change: T20A
SMART Domains Protein: ENSMUSP00000134916
Gene: ENSMUSG00000021147
AA Change: T20A

DomainStartEndE-ValueType
WD40 26 66 9.75e-3 SMART
WD40 69 113 3.81e-5 SMART
WD40 118 156 2.38e-6 SMART
Blast:WD40 160 193 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176587
SMART Domains Protein: ENSMUSP00000135271
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 62 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176715
Predicted Effect probably benign
Transcript: ENSMUST00000176813
AA Change: T140A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135097
Gene: ENSMUSG00000021147
AA Change: T140A

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
SCOP:d1ijqa1 128 180 3e-4 SMART
Blast:WD40 145 180 5e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176922
SMART Domains Protein: ENSMUSP00000135742
Gene: ENSMUSG00000021147

DomainStartEndE-ValueType
coiled coil region 63 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177537
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ap3m1 T C 14: 21,038,028 M107V probably benign Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Other mutations in Wdr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr37 APN 13 8820505 missense probably damaging 1.00
IGL00753:Wdr37 APN 13 8861174 missense probably damaging 1.00
IGL02479:Wdr37 APN 13 8842784 missense probably damaging 1.00
profound UTSW 13 8842728 critical splice donor site probably null
radical UTSW 13 8847674 unclassified probably null
R0885:Wdr37 UTSW 13 8835252 intron probably null
R1073:Wdr37 UTSW 13 8805840 missense probably damaging 0.99
R1085:Wdr37 UTSW 13 8805928 missense probably damaging 1.00
R1537:Wdr37 UTSW 13 8837003 missense probably benign 0.01
R1538:Wdr37 UTSW 13 8836792 missense probably benign
R1541:Wdr37 UTSW 13 8820538 missense probably benign 0.26
R1868:Wdr37 UTSW 13 8836851 missense probably damaging 1.00
R2240:Wdr37 UTSW 13 8861232 start gained probably benign
R3815:Wdr37 UTSW 13 8853596 intron probably benign
R3817:Wdr37 UTSW 13 8853596 intron probably benign
R3818:Wdr37 UTSW 13 8853596 intron probably benign
R3819:Wdr37 UTSW 13 8853596 intron probably benign
R4721:Wdr37 UTSW 13 8854029 missense possibly damaging 0.89
R5080:Wdr37 UTSW 13 8847674 unclassified probably null
R6297:Wdr37 UTSW 13 8842728 critical splice donor site probably null
R7505:Wdr37 UTSW 13 8819935 missense probably damaging 1.00
R7840:Wdr37 UTSW 13 8836875 missense probably damaging 0.96
R7873:Wdr37 UTSW 13 8805933 missense probably damaging 0.99
R7923:Wdr37 UTSW 13 8836875 missense probably damaging 0.96
R7956:Wdr37 UTSW 13 8805933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTACTGCCAACTGAAAGTC -3'
(R):5'- TGAGGCATCTCAGTTCTGC -3'

Sequencing Primer
(F):5'- AAGTCACTTCCATCAGTTATCAGTC -3'
(R):5'- GAGGCATCTCAGTTCTGCTCATG -3'
Posted On2018-08-29