Incidental Mutation 'R6761:Mslnl'
ID 531717
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 044877-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6761 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25965047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 471 (D471G)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: D471G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: D471G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,878,845 (GRCm39) V61A probably benign Het
Actr3b C T 5: 26,030,137 (GRCm39) S67F probably damaging Het
Ap3m1 T C 14: 21,088,096 (GRCm39) M107V probably benign Het
Ccdc27 C T 4: 154,122,155 (GRCm39) G241D unknown Het
Cit T G 5: 116,046,734 (GRCm39) D382E probably damaging Het
Clec3b G T 9: 122,986,004 (GRCm39) G134V probably damaging Het
Cntnap2 T A 6: 47,026,307 (GRCm39) H44Q probably benign Het
Dst T C 1: 34,253,631 (GRCm39) S4300P probably damaging Het
Ebna1bp2 C T 4: 118,480,558 (GRCm39) R134* probably null Het
Efcab14 T C 4: 115,596,024 (GRCm39) S57P probably damaging Het
Exosc2 T C 2: 31,560,875 (GRCm39) probably null Het
Hfm1 T C 5: 107,043,145 (GRCm39) T630A probably damaging Het
Hkdc1 A T 10: 62,244,477 (GRCm39) I203N possibly damaging Het
Hltf T A 3: 20,137,996 (GRCm39) probably null Het
Igkv3-2 G T 6: 70,675,501 (GRCm39) probably benign Het
Msmo1 A G 8: 65,172,061 (GRCm39) Y281H probably benign Het
Nid1 A G 13: 13,656,620 (GRCm39) T584A probably benign Het
Olfr908 A G 9: 38,427,561 (GRCm39) T78A probably damaging Het
Or52a24 C T 7: 103,381,691 (GRCm39) A186V probably damaging Het
Otoa G A 7: 120,721,173 (GRCm39) G396D probably damaging Het
Prss45 G T 9: 110,669,487 (GRCm39) A197S probably damaging Het
Prxl2a T A 14: 40,716,578 (GRCm39) H198L probably damaging Het
Rpap2 T A 5: 107,768,104 (GRCm39) I314N probably benign Het
Sash1 A G 10: 8,620,286 (GRCm39) M458T probably damaging Het
Slc44a5 A G 3: 153,945,714 (GRCm39) probably null Het
Sorbs2 T C 8: 46,225,651 (GRCm39) S254P probably damaging Het
Sycp2 T C 2: 178,016,144 (GRCm39) probably null Het
Tedc1 A G 12: 113,125,334 (GRCm39) D252G probably damaging Het
Uty T C Y: 1,186,790 (GRCm39) H145R probably damaging Homo
Vmn1r9 A G 6: 57,048,291 (GRCm39) Y122C probably benign Het
Wdfy4 T A 14: 32,817,908 (GRCm39) N1491Y possibly damaging Het
Wdr37 T C 13: 8,899,684 (GRCm39) T140A probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTGACTAAATTCTCTAGGCCTTTC -3'
(R):5'- AAGTTCCTCCAAAGGGGCAC -3'

Sequencing Primer
(F):5'- TTTGTATCCTACAGACACCAGGAGG -3'
(R):5'- GCACCACCTAGAGGGAGTG -3'
Posted On 2018-08-29