Incidental Mutation 'R6761:2300002M23Rik'
ID 531718
Institutional Source Beutler Lab
Gene Symbol 2300002M23Rik
Ensembl Gene ENSMUSG00000039269
Gene Name RIKEN cDNA 2300002M23 gene
Synonyms emprin
MMRRC Submission 044877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R6761 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35878382-35879842 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35878845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 61 (V61A)
Ref Sequence ENSEMBL: ENSMUSP00000038043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044326]
AlphaFold Q8BM15
Predicted Effect probably benign
Transcript: ENSMUST00000044326
AA Change: V61A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000038043
Gene: ENSMUSG00000039269
AA Change: V61A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:STG 34 260 4.8e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174246
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype PHENOTYPE: Female homozygous null mice exhibit reduced body weight and total body fat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b C T 5: 26,030,137 (GRCm39) S67F probably damaging Het
Ap3m1 T C 14: 21,088,096 (GRCm39) M107V probably benign Het
Ccdc27 C T 4: 154,122,155 (GRCm39) G241D unknown Het
Cit T G 5: 116,046,734 (GRCm39) D382E probably damaging Het
Clec3b G T 9: 122,986,004 (GRCm39) G134V probably damaging Het
Cntnap2 T A 6: 47,026,307 (GRCm39) H44Q probably benign Het
Dst T C 1: 34,253,631 (GRCm39) S4300P probably damaging Het
Ebna1bp2 C T 4: 118,480,558 (GRCm39) R134* probably null Het
Efcab14 T C 4: 115,596,024 (GRCm39) S57P probably damaging Het
Exosc2 T C 2: 31,560,875 (GRCm39) probably null Het
Hfm1 T C 5: 107,043,145 (GRCm39) T630A probably damaging Het
Hkdc1 A T 10: 62,244,477 (GRCm39) I203N possibly damaging Het
Hltf T A 3: 20,137,996 (GRCm39) probably null Het
Igkv3-2 G T 6: 70,675,501 (GRCm39) probably benign Het
Mslnl A G 17: 25,965,047 (GRCm39) D471G probably damaging Het
Msmo1 A G 8: 65,172,061 (GRCm39) Y281H probably benign Het
Nid1 A G 13: 13,656,620 (GRCm39) T584A probably benign Het
Olfr908 A G 9: 38,427,561 (GRCm39) T78A probably damaging Het
Or52a24 C T 7: 103,381,691 (GRCm39) A186V probably damaging Het
Otoa G A 7: 120,721,173 (GRCm39) G396D probably damaging Het
Prss45 G T 9: 110,669,487 (GRCm39) A197S probably damaging Het
Prxl2a T A 14: 40,716,578 (GRCm39) H198L probably damaging Het
Rpap2 T A 5: 107,768,104 (GRCm39) I314N probably benign Het
Sash1 A G 10: 8,620,286 (GRCm39) M458T probably damaging Het
Slc44a5 A G 3: 153,945,714 (GRCm39) probably null Het
Sorbs2 T C 8: 46,225,651 (GRCm39) S254P probably damaging Het
Sycp2 T C 2: 178,016,144 (GRCm39) probably null Het
Tedc1 A G 12: 113,125,334 (GRCm39) D252G probably damaging Het
Uty T C Y: 1,186,790 (GRCm39) H145R probably damaging Homo
Vmn1r9 A G 6: 57,048,291 (GRCm39) Y122C probably benign Het
Wdfy4 T A 14: 32,817,908 (GRCm39) N1491Y possibly damaging Het
Wdr37 T C 13: 8,899,684 (GRCm39) T140A probably benign Het
Other mutations in 2300002M23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:2300002M23Rik APN 17 35,878,730 (GRCm39) critical splice acceptor site probably null
IGL02604:2300002M23Rik APN 17 35,878,845 (GRCm39) missense probably benign 0.01
R1154:2300002M23Rik UTSW 17 35,879,673 (GRCm39) missense probably damaging 1.00
R2184:2300002M23Rik UTSW 17 35,879,115 (GRCm39) missense probably benign
R2406:2300002M23Rik UTSW 17 35,879,352 (GRCm39) missense probably damaging 0.96
R3824:2300002M23Rik UTSW 17 35,878,508 (GRCm39) missense probably benign
R4739:2300002M23Rik UTSW 17 35,878,403 (GRCm39) utr 5 prime probably benign
R4936:2300002M23Rik UTSW 17 35,879,212 (GRCm39) missense possibly damaging 0.92
R5318:2300002M23Rik UTSW 17 35,878,883 (GRCm39) missense possibly damaging 0.95
R5459:2300002M23Rik UTSW 17 35,879,079 (GRCm39) missense possibly damaging 0.91
R6453:2300002M23Rik UTSW 17 35,879,109 (GRCm39) missense possibly damaging 0.71
R7847:2300002M23Rik UTSW 17 35,879,549 (GRCm39) missense probably benign
R9406:2300002M23Rik UTSW 17 35,879,487 (GRCm39) missense possibly damaging 0.96
RF010:2300002M23Rik UTSW 17 35,879,473 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCAGTACAGAATCAGGC -3'
(R):5'- GCATTTGCTCTAACTGGTCCTCAG -3'

Sequencing Primer
(F):5'- GTACAGAATCAGGCATTCAGC -3'
(R):5'- TGGTCCTCAGCAACAGCAG -3'
Posted On 2018-08-29