Incidental Mutation 'R6762:Dnah7b'
ID 531720
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms LOC227058, Dnahc7b
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46105475-46412710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46263902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2128 (V2128A)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069293
AA Change: V2128A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: V2128A

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,181,309 (GRCm39) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,250,497 (GRCm39) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,263,811 (GRCm39) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,105,889 (GRCm39) unclassified probably benign
IGL00950:Dnah7b APN 1 46,253,482 (GRCm39) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,234,538 (GRCm39) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,120,592 (GRCm39) splice site probably benign
IGL01392:Dnah7b APN 1 46,165,948 (GRCm39) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,155,460 (GRCm39) splice site probably benign
IGL01460:Dnah7b APN 1 46,178,864 (GRCm39) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,307,813 (GRCm39) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,397,307 (GRCm39) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,397,297 (GRCm39) nonsense probably null
IGL01906:Dnah7b APN 1 46,214,613 (GRCm39) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,163,497 (GRCm39) splice site probably benign
IGL01989:Dnah7b APN 1 46,328,694 (GRCm39) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,179,035 (GRCm39) missense probably benign
IGL02213:Dnah7b APN 1 46,272,752 (GRCm39) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,266,090 (GRCm39) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,138,663 (GRCm39) nonsense probably null
IGL02381:Dnah7b APN 1 46,316,280 (GRCm39) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,273,353 (GRCm39) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,234,478 (GRCm39) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,162,937 (GRCm39) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,155,461 (GRCm39) splice site probably benign
IGL02704:Dnah7b APN 1 46,181,293 (GRCm39) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,138,768 (GRCm39) splice site probably benign
IGL02745:Dnah7b APN 1 46,234,189 (GRCm39) splice site probably benign
IGL02818:Dnah7b APN 1 46,329,968 (GRCm39) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,158,458 (GRCm39) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,221,535 (GRCm39) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,124,849 (GRCm39) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,158,464 (GRCm39) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,412,508 (GRCm39) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,252,520 (GRCm39) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,262,338 (GRCm39) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,258,508 (GRCm39) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,162,937 (GRCm39) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,246,803 (GRCm39) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,173,816 (GRCm39) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,280,104 (GRCm39) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,316,286 (GRCm39) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,275,948 (GRCm39) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,179,336 (GRCm39) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,258,704 (GRCm39) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,280,152 (GRCm39) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,379,292 (GRCm39) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,138,772 (GRCm39) splice site probably benign
R1035:Dnah7b UTSW 1 46,163,608 (GRCm39) missense probably benign
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,364,970 (GRCm39) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,379,280 (GRCm39) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,138,669 (GRCm39) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,328,816 (GRCm39) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,117,753 (GRCm39) splice site probably benign
R1484:Dnah7b UTSW 1 46,176,703 (GRCm39) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,216,441 (GRCm39) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,105,957 (GRCm39) missense unknown
R1607:Dnah7b UTSW 1 46,329,806 (GRCm39) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,392,126 (GRCm39) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,214,550 (GRCm39) nonsense probably null
R1681:Dnah7b UTSW 1 46,363,872 (GRCm39) nonsense probably null
R1716:Dnah7b UTSW 1 46,230,943 (GRCm39) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,272,919 (GRCm39) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,316,265 (GRCm39) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,155,337 (GRCm39) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,275,874 (GRCm39) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,281,263 (GRCm39) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,181,247 (GRCm39) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,281,481 (GRCm39) nonsense probably null
R2083:Dnah7b UTSW 1 46,280,227 (GRCm39) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,137,152 (GRCm39) splice site probably benign
R2172:Dnah7b UTSW 1 46,163,672 (GRCm39) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,240,344 (GRCm39) splice site probably benign
R2247:Dnah7b UTSW 1 46,316,223 (GRCm39) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,273,075 (GRCm39) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,402,114 (GRCm39) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,234,447 (GRCm39) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,178,901 (GRCm39) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,246,732 (GRCm39) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,227,847 (GRCm39) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,221,583 (GRCm39) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,307,869 (GRCm39) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,392,033 (GRCm39) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,339,035 (GRCm39) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,282,417 (GRCm39) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,176,645 (GRCm39) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,272,871 (GRCm39) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,120,655 (GRCm39) missense probably benign
R4172:Dnah7b UTSW 1 46,266,106 (GRCm39) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,176,578 (GRCm39) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,260,932 (GRCm39) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
R4414:Dnah7b UTSW 1 46,165,840 (GRCm39) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,124,792 (GRCm39) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,328,696 (GRCm39) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,117,684 (GRCm39) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,256,317 (GRCm39) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,250,488 (GRCm39) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,246,816 (GRCm39) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,106,115 (GRCm39) missense unknown
R4780:Dnah7b UTSW 1 46,392,174 (GRCm39) missense probably benign
R4828:Dnah7b UTSW 1 46,167,272 (GRCm39) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,395,762 (GRCm39) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,234,234 (GRCm39) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,120,604 (GRCm39) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,240,478 (GRCm39) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,329,935 (GRCm39) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,272,886 (GRCm39) missense probably benign
R5000:Dnah7b UTSW 1 46,138,663 (GRCm39) nonsense probably null
R5005:Dnah7b UTSW 1 46,281,188 (GRCm39) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,226,523 (GRCm39) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,221,540 (GRCm39) nonsense probably null
R5174:Dnah7b UTSW 1 46,282,509 (GRCm39) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,397,376 (GRCm39) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,273,018 (GRCm39) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,412,514 (GRCm39) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,272,849 (GRCm39) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,256,351 (GRCm39) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,227,819 (GRCm39) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,397,431 (GRCm39) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,281,366 (GRCm39) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,281,179 (GRCm39) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,148,472 (GRCm39) missense probably null
R5479:Dnah7b UTSW 1 46,262,265 (GRCm39) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,281,359 (GRCm39) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,395,674 (GRCm39) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,307,924 (GRCm39) splice site probably null
R5659:Dnah7b UTSW 1 46,392,009 (GRCm39) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,273,152 (GRCm39) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,316,280 (GRCm39) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,181,292 (GRCm39) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,230,885 (GRCm39) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,376,753 (GRCm39) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,260,803 (GRCm39) missense probably benign
R5941:Dnah7b UTSW 1 46,226,450 (GRCm39) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,402,147 (GRCm39) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,158,558 (GRCm39) splice site probably null
R6041:Dnah7b UTSW 1 46,328,805 (GRCm39) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,178,949 (GRCm39) missense probably benign
R6049:Dnah7b UTSW 1 46,124,762 (GRCm39) missense probably benign
R6131:Dnah7b UTSW 1 46,292,626 (GRCm39) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,329,863 (GRCm39) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,272,745 (GRCm39) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,165,828 (GRCm39) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,265,048 (GRCm39) missense probably benign
R6273:Dnah7b UTSW 1 46,281,476 (GRCm39) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,379,335 (GRCm39) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,281,364 (GRCm39) nonsense probably null
R6494:Dnah7b UTSW 1 46,138,591 (GRCm39) missense probably damaging 1.00
R6800:Dnah7b UTSW 1 46,379,377 (GRCm39) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,230,948 (GRCm39) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,234,280 (GRCm39) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,158,428 (GRCm39) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,397,398 (GRCm39) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,234,299 (GRCm39) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,275,969 (GRCm39) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,391,973 (GRCm39) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,178,870 (GRCm39) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,281,302 (GRCm39) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,179,126 (GRCm39) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,122,914 (GRCm39) missense probably benign
R7244:Dnah7b UTSW 1 46,316,303 (GRCm39) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,181,245 (GRCm39) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,234,532 (GRCm39) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,342,794 (GRCm39) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,214,579 (GRCm39) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,329,894 (GRCm39) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,364,925 (GRCm39) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,395,714 (GRCm39) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,163,506 (GRCm39) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,253,573 (GRCm39) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,307,794 (GRCm39) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,148,462 (GRCm39) missense probably benign
R7676:Dnah7b UTSW 1 46,273,324 (GRCm39) nonsense probably null
R7731:Dnah7b UTSW 1 46,178,905 (GRCm39) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,240,413 (GRCm39) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,176,634 (GRCm39) missense probably benign
R7807:Dnah7b UTSW 1 46,253,527 (GRCm39) missense probably benign
R7895:Dnah7b UTSW 1 46,289,110 (GRCm39) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,178,838 (GRCm39) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,266,163 (GRCm39) missense probably benign
R7946:Dnah7b UTSW 1 46,272,739 (GRCm39) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,282,584 (GRCm39) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,282,525 (GRCm39) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,263,866 (GRCm39) nonsense probably null
R8094:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,272,913 (GRCm39) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,292,671 (GRCm39) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,395,736 (GRCm39) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,179,032 (GRCm39) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,214,456 (GRCm39) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,395,819 (GRCm39) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,227,839 (GRCm39) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,329,875 (GRCm39) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,138,650 (GRCm39) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,155,360 (GRCm39) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,214,598 (GRCm39) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,221,624 (GRCm39) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,392,159 (GRCm39) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,162,806 (GRCm39) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,273,305 (GRCm39) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,230,953 (GRCm39) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,280,236 (GRCm39) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,292,534 (GRCm39) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,262,232 (GRCm39) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,282,575 (GRCm39) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,173,674 (GRCm39) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,266,180 (GRCm39) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,181,194 (GRCm39) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,330,038 (GRCm39) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,361,420 (GRCm39) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,272,914 (GRCm39) nonsense probably null
R9392:Dnah7b UTSW 1 46,162,898 (GRCm39) nonsense probably null
R9456:Dnah7b UTSW 1 46,165,953 (GRCm39) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,253,564 (GRCm39) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,264,956 (GRCm39) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,292,621 (GRCm39) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,252,544 (GRCm39) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
RF020:Dnah7b UTSW 1 46,412,421 (GRCm39) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,412,458 (GRCm39) nonsense probably null
X0023:Dnah7b UTSW 1 46,342,737 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGCATCACTTATGTAGTAGGG -3'
(R):5'- ACTAGCAAGACAGGCTATGC -3'

Sequencing Primer
(F):5'- CTCACTAATGTAGCCCTAGGTAGG -3'
(R):5'- CTAGCAAGACAGGCTATGCAATAGTG -3'
Posted On 2018-08-29