Incidental Mutation 'R6762:Olfr1085'
ID531723
Institutional Source Beutler Lab
Gene Symbol Olfr1085
Ensembl Gene ENSMUSG00000075176
Gene Nameolfactory receptor 1085
SynonymsGA_x6K02T2Q125-48147264-48146323, MOR191-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6762 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86653665-86662019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86657844 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 205 (F205I)
Ref Sequence ENSEMBL: ENSMUSP00000150955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]
Predicted Effect probably benign
Transcript: ENSMUST00000099879
AA Change: F205I

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: F205I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213279
AA Change: F205I

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214566
AA Change: F205I

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Olfr1085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr1085 APN 2 86657726 missense probably damaging 0.98
IGL01137:Olfr1085 APN 2 86657711 missense possibly damaging 0.92
IGL01329:Olfr1085 APN 2 86658207 missense probably benign 0.31
IGL01398:Olfr1085 APN 2 86657688 missense probably damaging 1.00
IGL02248:Olfr1085 APN 2 86657717 missense probably damaging 1.00
IGL02699:Olfr1085 APN 2 86658347 missense probably benign 0.34
IGL02818:Olfr1085 APN 2 86657784 missense probably damaging 1.00
IGL03095:Olfr1085 APN 2 86658431 missense possibly damaging 0.50
IGL03218:Olfr1085 APN 2 86658359 missense probably benign 0.32
R0121:Olfr1085 UTSW 2 86657819 missense probably benign 0.42
R0546:Olfr1085 UTSW 2 86657891 missense possibly damaging 0.91
R0583:Olfr1085 UTSW 2 86658360 missense probably benign 0.20
R0980:Olfr1085 UTSW 2 86657865 missense probably benign 0.39
R2067:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R2111:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R3760:Olfr1085 UTSW 2 86657888 missense possibly damaging 0.91
R4530:Olfr1085 UTSW 2 86657561 missense probably benign 0.00
R4809:Olfr1085 UTSW 2 86657685 missense possibly damaging 0.95
R5940:Olfr1085 UTSW 2 86658050 missense probably damaging 0.98
R6027:Olfr1085 UTSW 2 86657804 missense probably damaging 1.00
R6417:Olfr1085 UTSW 2 86658166 nonsense probably null
R6420:Olfr1085 UTSW 2 86658166 nonsense probably null
R6619:Olfr1085 UTSW 2 86658062 missense probably damaging 1.00
R6946:Olfr1085 UTSW 2 86657588 missense probably damaging 1.00
R7673:Olfr1085 UTSW 2 86657726 missense probably damaging 1.00
R7718:Olfr1085 UTSW 2 86658029 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGATCAAGGGATTCAACATTGGG -3'
(R):5'- GGCGGTCCCATATATCTACAGTG -3'

Sequencing Primer
(F):5'- ACTGGACTTGGGCTGCACATAC -3'
(R):5'- GTGGCTACAATATCATCAATC -3'
Posted On2018-08-29