Mutagenetix > Incidental Mutation

Incidental Mutation 'R6762:Ugcg'

531726

Institutional Source

Beutler Lab

Gene Symbol

Ugcg

Ensembl Gene

ENSMUSG00000028381

Gene Name

UDP-glucose ceramide glucosyltransferase

Synonyms

Epcs21, Ugcgl, GlcT-1

MMRRC Submission

044878-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59189257-59222833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59219530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 289 (I289N)

Ref Sequence

ENSEMBL: ENSMUSP00000030074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030074]

AlphaFold

O88693

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030074
AA Change: I289N

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: I289N

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	51	278	1.3e-26	PFAM
Pfam:Glyco_transf_21	106	278	8.4e-61	PFAM
Pfam:Glyco_trans_2_3	139	368	9.6e-13	PFAM

Meta Mutation Damage Score

0.6356

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	A	G	9: 104,099,668	Y27H	probably benign	Het
Angptl3	T	A	4: 99,037,417	S327T	possibly damaging	Het
Arl6ip4	GGAAGAAGAAGAAGAAGAA	GGAAGAAGAAGAAGAAGAAGAA	5: 124,117,050		probably benign	Het
Cyp2s1	A	T	7: 25,808,070	L318H	probably damaging	Het
Dnah14	T	C	1: 181,757,259	L3185P	probably damaging	Het
Dnah7b	T	C	1: 46,224,742	V2128A	probably benign	Het
Ehhadh	A	T	16: 21,762,459	F594L	probably benign	Het
En2	A	G	5: 28,170,353	N298S	possibly damaging	Het
Epha5	T	A	5: 84,331,726	N140Y	probably damaging	Het
Fam151b	C	T	13: 92,468,050	V144I	possibly damaging	Het
Fanca	C	A	8: 123,271,303	A1215S	probably benign	Het
Fancd2	T	A	6: 113,586,016		probably null	Het
Fat2	T	C	11: 55,253,482		probably null	Het
Gm4513	T	C	7: 20,594,193	N31S	probably benign	Het
Hspg2	A	T	4: 137,551,803	I3066F	possibly damaging	Het
Krt10	T	C	11: 99,387,057	T355A	possibly damaging	Het
Lims1	C	A	10: 58,412,545	H275N	probably damaging	Het
Map3k19	C	T	1: 127,847,264	G112D	probably damaging	Het
Mdn1	T	A	4: 32,676,786	N619K	possibly damaging	Het
Mpp6	T	A	6: 50,180,438		probably null	Het
Mtor	A	G	4: 148,538,481	T1977A	possibly damaging	Het
Nos2	T	G	11: 78,959,748	L1144R	possibly damaging	Het
Olfr1085	A	T	2: 86,657,844	F205I	probably benign	Het
Olfr608	G	C	7: 103,470,389	V117L	probably benign	Het
Olfr780	G	A	10: 129,322,256	C211Y	probably damaging	Het
Pcdhga9	C	A	18: 37,737,268	S50Y	probably damaging	Het
Pfn4	T	A	12: 4,775,487	M108K	probably damaging	Het
Prep	T	C	10: 45,148,123		probably null	Het
Qtrt1	T	A	9: 21,412,082	H76Q	probably damaging	Het
Rpa1	T	A	11: 75,340,345	S73C	possibly damaging	Het
Senp5	A	G	16: 31,989,884	V157A	probably damaging	Het
Snapc3	T	C	4: 83,435,258	L178P	probably damaging	Het
Sptbn4	A	G	7: 27,394,208	F1340L	probably damaging	Het
Srd5a3	T	A	5: 76,153,551	I85K	probably benign	Het
Taar2	C	T	10: 23,941,402	T280M	probably damaging	Het
Tgfb3	T	C	12: 86,069,463	D177G	probably benign	Het
Tpt1	A	G	14: 75,846,381	D94G	probably benign	Het
Trpm4	A	G	7: 45,304,816		probably benign	Het
Trpv4	C	T	5: 114,625,110	R746H	probably benign	Het
Txndc2	T	C	17: 65,638,972	D70G	probably damaging	Het
Vmn2r2	C	G	3: 64,134,449	D282H	probably damaging	Het
Vmn2r50	A	T	7: 10,053,083	N32K	probably benign	Het
Wdpcp	C	T	11: 21,721,244	T495I	probably benign	Het
Zfp961	T	A	8: 71,966,114	C51S	possibly damaging	Het
Zxdc	C	T	6: 90,382,183	A599V	probably benign	Het

Other mutations in Ugcg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Ugcg	APN	4	59213865	missense	possibly damaging	0.94
IGL01768:Ugcg	APN	4	59217216	critical splice donor site	probably null
IGL02636:Ugcg	APN	4	59207763	missense	possibly damaging	0.73
IGL02672:Ugcg	APN	4	59218587	splice site	probably benign
IGL02798:Ugcg	APN	4	59220346	missense	probably damaging	1.00
congee	UTSW	4	59207798	missense	probably benign	0.17
cream_o_wheat	UTSW	4	59220387	missense	possibly damaging	0.91
gruel	UTSW	4	59189690	missense	probably benign
Porridge	UTSW	4	59219530	missense	possibly damaging	0.86
slop	UTSW	4	59211883	missense	probably benign	0.16
wheatina	UTSW	4	59220272	missense	probably damaging	0.96
PIT4382001:Ugcg	UTSW	4	59213246	missense	possibly damaging	0.68
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0013:Ugcg	UTSW	4	59213931	missense	possibly damaging	0.82
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0068:Ugcg	UTSW	4	59217130	missense	probably benign	0.16
R0119:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0230:Ugcg	UTSW	4	59189739	nonsense	probably null
R0299:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0384:Ugcg	UTSW	4	59220387	missense	possibly damaging	0.91
R0499:Ugcg	UTSW	4	59217036	missense	possibly damaging	0.85
R0645:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0688:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0726:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0802:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0803:Ugcg	UTSW	4	59189685	missense	probably benign	0.00
R0811:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0812:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0828:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0831:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0944:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0945:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R0947:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1104:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1209:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1210:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1252:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1253:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1255:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1488:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1490:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1548:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1698:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1771:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1776:Ugcg	UTSW	4	59207775	missense	probably benign	0.05
R1781:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1794:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R1840:Ugcg	UTSW	4	59219517	missense	probably damaging	1.00
R1942:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2228:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2229:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2237:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2239:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2314:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2338:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2340:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2422:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2426:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R2433:Ugcg	UTSW	4	59207876	missense	possibly damaging	0.89
R2680:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3076:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3078:Ugcg	UTSW	4	59213922	missense	probably damaging	1.00
R3689:Ugcg	UTSW	4	59211883	missense	probably benign	0.16
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3732:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3733:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3766:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3767:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3768:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3769:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3771:Ugcg	UTSW	4	59189690	missense	probably benign
R3847:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3848:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3916:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3917:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3958:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R3959:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4023:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4024:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4025:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4065:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4066:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
R4427:Ugcg	UTSW	4	59219555	missense	probably benign	0.02
R5842:Ugcg	UTSW	4	59219545	missense	possibly damaging	0.93
R6012:Ugcg	UTSW	4	59220272	missense	probably damaging	0.96
R6080:Ugcg	UTSW	4	59218524	missense	possibly damaging	0.70
R7194:Ugcg	UTSW	4	59213210	missense	probably damaging	0.99
R7286:Ugcg	UTSW	4	59217111	missense	possibly damaging	0.95
R7362:Ugcg	UTSW	4	59217109	missense	probably damaging	1.00
R7472:Ugcg	UTSW	4	59217156	missense	probably benign
R7638:Ugcg	UTSW	4	59220299	missense	probably benign	0.26
R7866:Ugcg	UTSW	4	59211927	missense	possibly damaging	0.71
R8170:Ugcg	UTSW	4	59211974	missense	possibly damaging	0.71
R8488:Ugcg	UTSW	4	59213896	missense	probably benign	0.00
R8793:Ugcg	UTSW	4	59207794	missense	probably benign	0.22
R9441:Ugcg	UTSW	4	59207843	missense	probably damaging	1.00
Y4336:Ugcg	UTSW	4	59207798	missense	probably benign	0.17
Y4337:Ugcg	UTSW	4	59207798	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGAGGATAGTCTTTCCATGTCAAGG -3'
(R):5'- TCCTTCCCCAGATCACTGAG -3'

Sequencing Primer
(F):5'- CAAGGTTGACCATGTGTGTGAGAG -3'
(R):5'- AGATCACTGAGAACCCTTTCCTGTG -3'

Posted On

2018-08-29