Incidental Mutation 'R6762:Snapc3'
ID 531727
Institutional Source Beutler Lab
Gene Symbol Snapc3
Ensembl Gene ENSMUSG00000028483
Gene Name small nuclear RNA activating complex, polypeptide 3
Synonyms 4930558A07Rik, E030018J20Rik, 5031401C21Rik, 1810020H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 83417724-83467676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83435258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 178 (L178P)
Ref Sequence ENSEMBL: ENSMUSP00000123793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030206] [ENSMUST00000071544] [ENSMUST00000123262] [ENSMUST00000124856] [ENSMUST00000137512] [ENSMUST00000143533]
AlphaFold Q9D2C9
Predicted Effect probably damaging
Transcript: ENSMUST00000030206
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030206
Gene: ENSMUSG00000028483
AA Change: L178P

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 198 401 6.5e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071544
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102842
Gene: ENSMUSG00000028483
AA Change: L178P

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 269 3.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123262
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124038
Gene: ENSMUSG00000028483
AA Change: L178P

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124856
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483
AA Change: L178P

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137512
Predicted Effect probably damaging
Transcript: ENSMUST00000143533
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483
AA Change: L178P

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Meta Mutation Damage Score 0.8689 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Snapc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Snapc3 APN 4 83436396 missense probably damaging 0.97
IGL01400:Snapc3 APN 4 83450177 missense probably damaging 1.00
IGL02031:Snapc3 APN 4 83417976 missense probably benign 0.04
IGL02475:Snapc3 APN 4 83450096 missense probably benign 0.04
IGL03141:Snapc3 APN 4 83435286 missense probably damaging 1.00
R0417:Snapc3 UTSW 4 83450162 missense probably benign 0.41
R0628:Snapc3 UTSW 4 83450160 missense probably benign 0.01
R0631:Snapc3 UTSW 4 83417802 missense probably damaging 0.99
R0647:Snapc3 UTSW 4 83450229 missense probably damaging 1.00
R2328:Snapc3 UTSW 4 83435277 nonsense probably null
R4454:Snapc3 UTSW 4 83418759 missense probably damaging 1.00
R4860:Snapc3 UTSW 4 83464897 intron probably benign
R6497:Snapc3 UTSW 4 83453126 nonsense probably null
R7325:Snapc3 UTSW 4 83435270 missense probably benign 0.04
R7599:Snapc3 UTSW 4 83417836 nonsense probably null
R7880:Snapc3 UTSW 4 83435194 missense probably damaging 1.00
R8489:Snapc3 UTSW 4 83451294 missense probably damaging 1.00
R9412:Snapc3 UTSW 4 83436333 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCATTCCTCACTTTGAATTAGAC -3'
(R):5'- CTGCAAAGTCAGCTACAAGC -3'

Sequencing Primer
(F):5'- CATTAGACCCAAGGTTGACTGGAGTC -3'
(R):5'- CTTGTCTTAAAAGCTTTGCCAAAGG -3'
Posted On 2018-08-29