Incidental Mutation 'R6762:Mtor'
ID 531730
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Name mechanistic target of rapamycin kinase
Synonyms flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 148533068-148642140 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148622938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1977 (T1977A)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
AlphaFold Q9JLN9
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: T1977A

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: T1977A

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148,537,494 (GRCm39) missense probably benign 0.06
IGL01447:Mtor APN 4 148,615,214 (GRCm39) missense possibly damaging 0.62
IGL01551:Mtor APN 4 148,556,494 (GRCm39) missense probably damaging 0.99
IGL01661:Mtor APN 4 148,599,308 (GRCm39) missense possibly damaging 0.61
IGL01675:Mtor APN 4 148,569,111 (GRCm39) missense probably benign 0.00
IGL01743:Mtor APN 4 148,615,070 (GRCm39) splice site probably benign
IGL02015:Mtor APN 4 148,624,570 (GRCm39) nonsense probably null
IGL02084:Mtor APN 4 148,555,137 (GRCm39) missense probably damaging 0.98
IGL02095:Mtor APN 4 148,628,998 (GRCm39) missense probably damaging 1.00
IGL02129:Mtor APN 4 148,634,302 (GRCm39) missense possibly damaging 0.91
IGL02260:Mtor APN 4 148,622,758 (GRCm39) missense probably damaging 1.00
IGL02329:Mtor APN 4 148,619,396 (GRCm39) missense probably benign 0.16
IGL02440:Mtor APN 4 148,576,104 (GRCm39) missense probably benign 0.04
IGL02440:Mtor APN 4 148,630,886 (GRCm39) missense probably benign 0.24
IGL02449:Mtor APN 4 148,618,378 (GRCm39) missense possibly damaging 0.65
IGL02479:Mtor APN 4 148,555,041 (GRCm39) missense probably damaging 1.00
IGL02904:Mtor APN 4 148,576,069 (GRCm39) splice site probably benign
IGL02904:Mtor APN 4 148,536,851 (GRCm39) missense possibly damaging 0.55
IGL02931:Mtor APN 4 148,549,421 (GRCm39) missense probably benign 0.22
IGL03048:Mtor APN 4 148,630,847 (GRCm39) splice site probably benign
IGL03133:Mtor APN 4 148,568,776 (GRCm39) missense probably benign 0.01
IGL03142:Mtor APN 4 148,538,356 (GRCm39) missense probably benign 0.00
Brushes UTSW 4 148,548,205 (GRCm39) missense probably benign 0.00
Dynamo UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
engine UTSW 4 148,641,312 (GRCm39) splice site probably null
Erg UTSW 4 148,630,053 (GRCm39) missense probably damaging 1.00
Lindor UTSW 4 148,539,103 (GRCm39) missense probably damaging 1.00
motor UTSW 4 148,575,817 (GRCm39) missense possibly damaging 0.76
R4858_Mtor_211 UTSW 4 148,539,273 (GRCm39) makesense probably null
Vigor UTSW 4 148,623,356 (GRCm39) missense probably damaging 1.00
Vim UTSW 4 148,610,260 (GRCm39) critical splice donor site probably null
PIT4519001:Mtor UTSW 4 148,608,957 (GRCm39) missense probably damaging 1.00
R0045:Mtor UTSW 4 148,549,406 (GRCm39) missense probably benign 0.42
R0048:Mtor UTSW 4 148,623,338 (GRCm39) nonsense probably null
R0048:Mtor UTSW 4 148,623,338 (GRCm39) nonsense probably null
R0103:Mtor UTSW 4 148,618,359 (GRCm39) missense probably benign 0.05
R0112:Mtor UTSW 4 148,565,380 (GRCm39) missense probably damaging 1.00
R0137:Mtor UTSW 4 148,555,081 (GRCm39) missense possibly damaging 0.78
R0184:Mtor UTSW 4 148,549,428 (GRCm39) missense probably benign 0.05
R0208:Mtor UTSW 4 148,549,432 (GRCm39) missense probably benign 0.43
R0329:Mtor UTSW 4 148,568,837 (GRCm39) missense probably benign
R0330:Mtor UTSW 4 148,568,837 (GRCm39) missense probably benign
R0365:Mtor UTSW 4 148,570,507 (GRCm39) missense probably benign 0.01
R0537:Mtor UTSW 4 148,622,817 (GRCm39) missense probably damaging 1.00
R0542:Mtor UTSW 4 148,624,907 (GRCm39) missense probably benign 0.02
R0556:Mtor UTSW 4 148,553,837 (GRCm39) missense possibly damaging 0.88
R0613:Mtor UTSW 4 148,610,503 (GRCm39) missense possibly damaging 0.95
R0646:Mtor UTSW 4 148,568,811 (GRCm39) nonsense probably null
R0710:Mtor UTSW 4 148,548,848 (GRCm39) missense possibly damaging 0.73
R0791:Mtor UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
R0792:Mtor UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
R0866:Mtor UTSW 4 148,570,513 (GRCm39) missense probably benign 0.04
R0973:Mtor UTSW 4 148,634,645 (GRCm39) missense probably damaging 1.00
R1027:Mtor UTSW 4 148,624,456 (GRCm39) missense probably benign 0.03
R1028:Mtor UTSW 4 148,623,287 (GRCm39) missense possibly damaging 0.88
R1289:Mtor UTSW 4 148,554,764 (GRCm39) missense probably benign 0.10
R1416:Mtor UTSW 4 148,575,871 (GRCm39) nonsense probably null
R1465:Mtor UTSW 4 148,610,450 (GRCm39) splice site probably benign
R1506:Mtor UTSW 4 148,620,962 (GRCm39) splice site probably benign
R1624:Mtor UTSW 4 148,632,133 (GRCm39) missense probably damaging 1.00
R1695:Mtor UTSW 4 148,623,364 (GRCm39) missense probably benign 0.08
R1771:Mtor UTSW 4 148,555,081 (GRCm39) missense possibly damaging 0.78
R1800:Mtor UTSW 4 148,547,349 (GRCm39) missense probably benign 0.00
R1855:Mtor UTSW 4 148,637,546 (GRCm39) missense probably benign 0.02
R1857:Mtor UTSW 4 148,565,336 (GRCm39) missense probably damaging 1.00
R1867:Mtor UTSW 4 148,539,089 (GRCm39) missense probably damaging 0.97
R1954:Mtor UTSW 4 148,552,730 (GRCm39) missense probably damaging 1.00
R2054:Mtor UTSW 4 148,550,482 (GRCm39) missense probably benign 0.00
R2054:Mtor UTSW 4 148,547,309 (GRCm39) missense probably benign 0.05
R2099:Mtor UTSW 4 148,634,649 (GRCm39) nonsense probably null
R2148:Mtor UTSW 4 148,540,469 (GRCm39) missense possibly damaging 0.56
R2214:Mtor UTSW 4 148,623,327 (GRCm39) missense probably benign 0.39
R2281:Mtor UTSW 4 148,574,012 (GRCm39) missense probably benign 0.02
R2512:Mtor UTSW 4 148,614,948 (GRCm39) missense possibly damaging 0.95
R2870:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2870:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2871:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2871:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2872:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2872:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2873:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R4032:Mtor UTSW 4 148,621,209 (GRCm39) missense probably benign 0.03
R4073:Mtor UTSW 4 148,633,832 (GRCm39) missense probably damaging 0.99
R4273:Mtor UTSW 4 148,634,609 (GRCm39) missense probably benign 0.21
R4611:Mtor UTSW 4 148,570,576 (GRCm39) missense probably benign 0.03
R4858:Mtor UTSW 4 148,539,273 (GRCm39) makesense probably null
R4942:Mtor UTSW 4 148,556,599 (GRCm39) missense probably benign 0.03
R4967:Mtor UTSW 4 148,575,817 (GRCm39) missense possibly damaging 0.76
R4995:Mtor UTSW 4 148,610,209 (GRCm39) missense probably damaging 1.00
R5054:Mtor UTSW 4 148,641,312 (GRCm39) splice site probably null
R5215:Mtor UTSW 4 148,538,440 (GRCm39) missense probably benign
R5249:Mtor UTSW 4 148,548,189 (GRCm39) missense probably damaging 1.00
R5289:Mtor UTSW 4 148,550,549 (GRCm39) missense possibly damaging 0.88
R5365:Mtor UTSW 4 148,634,587 (GRCm39) missense probably damaging 0.99
R5498:Mtor UTSW 4 148,624,821 (GRCm39) missense possibly damaging 0.71
R5514:Mtor UTSW 4 148,630,901 (GRCm39) missense probably damaging 1.00
R5540:Mtor UTSW 4 148,539,165 (GRCm39) missense probably benign 0.01
R5600:Mtor UTSW 4 148,575,927 (GRCm39) missense probably damaging 1.00
R5615:Mtor UTSW 4 148,622,733 (GRCm39) missense possibly damaging 0.95
R5632:Mtor UTSW 4 148,553,463 (GRCm39) missense possibly damaging 0.94
R5641:Mtor UTSW 4 148,630,882 (GRCm39) missense probably damaging 0.98
R5834:Mtor UTSW 4 148,620,993 (GRCm39) missense possibly damaging 0.95
R5984:Mtor UTSW 4 148,623,284 (GRCm39) missense probably benign 0.02
R6056:Mtor UTSW 4 148,621,892 (GRCm39) missense probably benign 0.00
R6225:Mtor UTSW 4 148,605,794 (GRCm39) missense probably benign 0.04
R6262:Mtor UTSW 4 148,610,552 (GRCm39) missense possibly damaging 0.46
R6335:Mtor UTSW 4 148,550,384 (GRCm39) missense probably damaging 1.00
R6479:Mtor UTSW 4 148,635,457 (GRCm39) missense probably benign 0.16
R6543:Mtor UTSW 4 148,630,053 (GRCm39) missense probably damaging 1.00
R6711:Mtor UTSW 4 148,536,824 (GRCm39) missense possibly damaging 0.49
R6715:Mtor UTSW 4 148,623,004 (GRCm39) missense probably benign 0.00
R6744:Mtor UTSW 4 148,543,112 (GRCm39) missense probably benign 0.01
R6748:Mtor UTSW 4 148,634,641 (GRCm39) missense probably damaging 1.00
R6836:Mtor UTSW 4 148,573,955 (GRCm39) missense possibly damaging 0.94
R6948:Mtor UTSW 4 148,621,209 (GRCm39) missense probably benign 0.12
R6979:Mtor UTSW 4 148,608,930 (GRCm39) missense possibly damaging 0.60
R6992:Mtor UTSW 4 148,548,932 (GRCm39) missense probably benign
R7271:Mtor UTSW 4 148,630,942 (GRCm39) missense possibly damaging 0.70
R7423:Mtor UTSW 4 148,640,801 (GRCm39) missense possibly damaging 0.77
R7434:Mtor UTSW 4 148,549,416 (GRCm39) missense probably benign 0.39
R7619:Mtor UTSW 4 148,547,252 (GRCm39) missense probably damaging 0.98
R7634:Mtor UTSW 4 148,536,807 (GRCm39) missense possibly damaging 0.53
R7697:Mtor UTSW 4 148,624,765 (GRCm39) nonsense probably null
R7737:Mtor UTSW 4 148,623,195 (GRCm39) missense possibly damaging 0.95
R7791:Mtor UTSW 4 148,547,397 (GRCm39) missense probably benign 0.00
R7858:Mtor UTSW 4 148,539,103 (GRCm39) missense probably damaging 1.00
R8035:Mtor UTSW 4 148,630,856 (GRCm39) missense probably benign 0.29
R8076:Mtor UTSW 4 148,610,260 (GRCm39) critical splice donor site probably null
R8078:Mtor UTSW 4 148,552,744 (GRCm39) missense probably benign
R8928:Mtor UTSW 4 148,623,356 (GRCm39) missense probably damaging 1.00
R9040:Mtor UTSW 4 148,548,205 (GRCm39) missense probably benign 0.00
R9116:Mtor UTSW 4 148,637,198 (GRCm39) missense probably benign
R9284:Mtor UTSW 4 148,543,537 (GRCm39) missense probably benign 0.03
R9310:Mtor UTSW 4 148,553,834 (GRCm39) missense probably benign 0.03
R9374:Mtor UTSW 4 148,599,397 (GRCm39) missense probably damaging 1.00
R9417:Mtor UTSW 4 148,622,776 (GRCm39) nonsense probably null
R9465:Mtor UTSW 4 148,624,839 (GRCm39) missense possibly damaging 0.92
R9492:Mtor UTSW 4 148,568,801 (GRCm39) missense probably damaging 1.00
R9499:Mtor UTSW 4 148,599,397 (GRCm39) missense probably damaging 1.00
R9516:Mtor UTSW 4 148,569,103 (GRCm39) missense probably benign 0.23
R9600:Mtor UTSW 4 148,632,092 (GRCm39) missense possibly damaging 0.82
R9622:Mtor UTSW 4 148,568,169 (GRCm39) missense probably damaging 0.99
X0025:Mtor UTSW 4 148,615,171 (GRCm39) missense probably benign 0.09
Z1176:Mtor UTSW 4 148,634,587 (GRCm39) missense possibly damaging 0.69
Z1176:Mtor UTSW 4 148,634,582 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGACACACCCAGACCCTTG -3'
(R):5'- CACCACAGGAAGCTACGATTG -3'

Sequencing Primer
(F):5'- TGGTGGGCCGGCTCATTC -3'
(R):5'- CTACGATTGGGAAGGTCTGGC -3'
Posted On 2018-08-29