Incidental Mutation 'R6762:En2'
ID 531731
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28170353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 298 (N298S)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect possibly damaging
Transcript: ENSMUST00000036177
AA Change: N298S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: N298S

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Meta Mutation Damage Score 0.2632 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCATGACAACCAGGTC -3'
(R):5'- CACTGGCCTTTTGTTCACGG -3'

Sequencing Primer
(F):5'- TGACAACCAGGTCCCAGGTC -3'
(R):5'- ATTGTTTCTCGCGGCCCTA -3'
Posted On 2018-08-29