Incidental Mutation 'R6762:Pals2'
ID 531736
Institutional Source Beutler Lab
Gene Symbol Pals2
Ensembl Gene ENSMUSG00000038388
Gene Name protein associated with LIN7 2, MAGUK family member
Synonyms P55t, Pals2, Mpp6
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 50087221-50175919 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 50157418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036225] [ENSMUST00000036236] [ENSMUST00000166318] [ENSMUST00000167628] [ENSMUST00000204545]
AlphaFold Q9JLB0
Predicted Effect probably null
Transcript: ENSMUST00000036225
SMART Domains Protein: ENSMUSP00000038772
Gene: ENSMUSG00000038388

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000036236
SMART Domains Protein: ENSMUSP00000039314
Gene: ENSMUSG00000038388

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166318
SMART Domains Protein: ENSMUSP00000125880
Gene: ENSMUSG00000038388

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
GuKc 350 541 8.92e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167628
SMART Domains Protein: ENSMUSP00000129355
Gene: ENSMUSG00000038388

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 231 296 7.52e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204545
SMART Domains Protein: ENSMUSP00000144737
Gene: ENSMUSG00000038388

DomainStartEndE-ValueType
L27 1 55 1.08e-9 SMART
L27 56 110 7.05e-14 SMART
PDZ 138 208 1.45e-11 SMART
SH3 217 282 7.52e-12 SMART
GuKc 336 527 8.92e-72 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the peripheral membrane-associated guanylate kinase (MAGUK) family function in tumor suppression and receptor clustering by forming multiprotein complexes containing distinct sets of transmembrane, cytoskeletal, and cytoplasmic signaling proteins. All MAGUKs contain a PDZ-SH3-GUK core and are divided into 4 subfamilies, DLG-like (see DLG1; MIM 601014), ZO1-like (see TJP1; MIM 601009), p55-like (see MPP1; MIM 305360), and LIN2-like (see CASK; MIM 300172), based on their size and the presence of additional domains. MPP6 is a member of the p55-like MAGUK subfamily (Tseng et al., 2001 [PubMed 11311936]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Pals2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Pals2 APN 6 50,173,569 (GRCm39) missense probably benign 0.26
IGL00944:Pals2 APN 6 50,140,436 (GRCm39) missense possibly damaging 0.96
IGL01576:Pals2 APN 6 50,140,472 (GRCm39) missense probably benign 0.02
IGL01639:Pals2 APN 6 50,155,460 (GRCm39) missense probably damaging 0.99
IGL02541:Pals2 APN 6 50,160,707 (GRCm39) missense probably benign 0.40
IGL02668:Pals2 APN 6 50,171,509 (GRCm39) missense probably damaging 1.00
R1033:Pals2 UTSW 6 50,160,716 (GRCm39) missense probably damaging 1.00
R1066:Pals2 UTSW 6 50,122,847 (GRCm39) missense possibly damaging 0.94
R1542:Pals2 UTSW 6 50,175,306 (GRCm39) missense probably damaging 1.00
R1799:Pals2 UTSW 6 50,173,525 (GRCm39) missense probably damaging 0.97
R1817:Pals2 UTSW 6 50,140,411 (GRCm39) missense probably benign 0.06
R1818:Pals2 UTSW 6 50,140,411 (GRCm39) missense probably benign 0.06
R4410:Pals2 UTSW 6 50,175,248 (GRCm39) nonsense probably null
R5162:Pals2 UTSW 6 50,155,495 (GRCm39) missense probably damaging 1.00
R5591:Pals2 UTSW 6 50,157,159 (GRCm39) missense probably benign 0.11
R6182:Pals2 UTSW 6 50,175,206 (GRCm39) missense probably benign
R6500:Pals2 UTSW 6 50,175,146 (GRCm39) missense possibly damaging 0.67
R6888:Pals2 UTSW 6 50,157,257 (GRCm39) critical splice donor site probably null
R6963:Pals2 UTSW 6 50,140,635 (GRCm39) splice site probably null
R7002:Pals2 UTSW 6 50,139,642 (GRCm39) missense probably benign
R7629:Pals2 UTSW 6 50,173,603 (GRCm39) missense probably benign 0.07
R8159:Pals2 UTSW 6 50,171,527 (GRCm39) missense probably benign 0.00
R9190:Pals2 UTSW 6 50,157,219 (GRCm39) missense probably damaging 1.00
R9266:Pals2 UTSW 6 50,140,463 (GRCm39) missense probably benign 0.07
R9604:Pals2 UTSW 6 50,173,597 (GRCm39) missense probably benign 0.11
X0027:Pals2 UTSW 6 50,140,511 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCTGATTCCAAGCCAGTTCC -3'
(R):5'- AGTTCCACAAAAGGGTCCTG -3'

Sequencing Primer
(F):5'- AAGGCATTTGTTCGCCGAGAC -3'
(R):5'- CTGGAGGATGACAAGACTTAATTTAG -3'
Posted On 2018-08-29