Incidental Mutation 'R6762:Zxdc'
ID 531737
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene Name ZXD family zinc finger C
Synonyms B930086F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 90369492-90403490 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90382183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 599 (A599V)
Ref Sequence ENSEMBL: ENSMUSP00000109167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
AlphaFold Q8C8V1
Predicted Effect probably benign
Transcript: ENSMUST00000045740
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075117
AA Change: A599V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: A599V

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113539
AA Change: A599V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: A599V

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203493
AA Change: A38V
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90373779 missense probably damaging 1.00
IGL01943:Zxdc APN 6 90372538 intron probably benign
IGL02406:Zxdc APN 6 90398836 missense probably benign 0.00
IGL02596:Zxdc APN 6 90373709 critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90382370 missense probably damaging 0.99
IGL02927:Zxdc APN 6 90372562 missense probably damaging 1.00
IGL03230:Zxdc APN 6 90373803 missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90373716 missense probably damaging 1.00
R0071:Zxdc UTSW 6 90370416 missense probably damaging 1.00
R0194:Zxdc UTSW 6 90372537 intron probably benign
R1065:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1377:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90378951 nonsense probably null
R2171:Zxdc UTSW 6 90382479 missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90370467 splice site probably null
R4400:Zxdc UTSW 6 90369810 missense probably damaging 1.00
R4660:Zxdc UTSW 6 90378838 missense probably damaging 0.99
R4776:Zxdc UTSW 6 90370518 missense probably damaging 1.00
R4781:Zxdc UTSW 6 90372553 missense probably damaging 0.98
R4843:Zxdc UTSW 6 90382272 missense probably damaging 1.00
R5028:Zxdc UTSW 6 90382338 missense probably benign 0.44
R5260:Zxdc UTSW 6 90382093 missense probably damaging 1.00
R5279:Zxdc UTSW 6 90370437 missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90373800 missense probably damaging 1.00
R5363:Zxdc UTSW 6 90382146 missense probably damaging 0.97
R5436:Zxdc UTSW 6 90370560 missense probably damaging 0.99
R5872:Zxdc UTSW 6 90370299 missense probably damaging 0.99
R5940:Zxdc UTSW 6 90370325 missense probably damaging 1.00
R7175:Zxdc UTSW 6 90369663 missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90378837 missense probably damaging 0.99
R7238:Zxdc UTSW 6 90369660 missense unknown
R7247:Zxdc UTSW 6 90384173 missense unknown
R7917:Zxdc UTSW 6 90382009 missense probably damaging 1.00
R7976:Zxdc UTSW 6 90398767 missense probably benign 0.05
R8792:Zxdc UTSW 6 90370004 missense probably benign 0.00
R8917:Zxdc UTSW 6 90382323 missense probably benign 0.00
R9016:Zxdc UTSW 6 90382272 missense probably damaging 1.00
R9076:Zxdc UTSW 6 90372839 missense probably damaging 1.00
R9190:Zxdc UTSW 6 90398791 missense probably damaging 0.96
R9216:Zxdc UTSW 6 90382207 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCGGATGAAGCACTGAACTC -3'
(R):5'- CCACCTTTATTGGAACCAGCAG -3'

Sequencing Primer
(F):5'- TGAAGCACTGAACTCTGGGATCC -3'
(R):5'- CACCTTTATTGGAACCAGCAGATCTG -3'
Posted On 2018-08-29