Incidental Mutation 'R6762:Vmn2r50'
ID 531738
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Name vomeronasal 2, receptor 50
Synonyms EG434117
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 9771162-9787105 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9787010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 32 (N32K)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
AlphaFold E9PW61
Predicted Effect probably benign
Transcript: ENSMUST00000074943
AA Change: N32K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: N32K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086298
AA Change: N32K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: N32K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 9,771,610 (GRCm39) missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 9,771,364 (GRCm39) missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 9,787,002 (GRCm39) missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 9,787,002 (GRCm39) missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 9,781,714 (GRCm39) missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 9,784,252 (GRCm39) missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 9,771,368 (GRCm39) missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 9,779,929 (GRCm39) missense probably damaging 0.99
PIT4651001:Vmn2r50 UTSW 7 9,771,659 (GRCm39) missense probably benign 0.30
R0530:Vmn2r50 UTSW 7 9,781,644 (GRCm39) missense possibly damaging 0.82
R1291:Vmn2r50 UTSW 7 9,771,404 (GRCm39) missense probably damaging 0.98
R1438:Vmn2r50 UTSW 7 9,784,062 (GRCm39) nonsense probably null
R1713:Vmn2r50 UTSW 7 9,771,731 (GRCm39) missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 9,781,605 (GRCm39) missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 9,786,915 (GRCm39) missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 9,781,610 (GRCm39) missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 9,787,026 (GRCm39) missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 9,781,640 (GRCm39) missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 9,771,851 (GRCm39) missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 9,774,309 (GRCm39) missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 9,786,922 (GRCm39) missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 9,781,834 (GRCm39) missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 9,784,235 (GRCm39) missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 9,784,235 (GRCm39) missense probably damaging 0.99
R4413:Vmn2r50 UTSW 7 9,784,235 (GRCm39) missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 9,771,162 (GRCm39) makesense probably null
R5151:Vmn2r50 UTSW 7 9,786,970 (GRCm39) missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 9,771,644 (GRCm39) missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 9,781,752 (GRCm39) missense probably damaging 1.00
R5457:Vmn2r50 UTSW 7 9,781,873 (GRCm39) missense probably damaging 0.98
R5559:Vmn2r50 UTSW 7 9,771,253 (GRCm39) missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 9,784,016 (GRCm39) missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 9,774,299 (GRCm39) missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 9,781,905 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 9,783,986 (GRCm39) missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 9,774,253 (GRCm39) missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 9,771,644 (GRCm39) missense probably damaging 1.00
R6995:Vmn2r50 UTSW 7 9,779,964 (GRCm39) nonsense probably null
R6998:Vmn2r50 UTSW 7 9,771,684 (GRCm39) missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 9,784,172 (GRCm39) missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 9,781,539 (GRCm39) missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 9,787,010 (GRCm39) missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 9,784,277 (GRCm39) critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 9,784,066 (GRCm39) missense probably null 0.00
R7704:Vmn2r50 UTSW 7 9,781,665 (GRCm39) missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 9,771,298 (GRCm39) missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 9,771,562 (GRCm39) missense possibly damaging 0.70
R7975:Vmn2r50 UTSW 7 9,771,272 (GRCm39) missense probably benign 0.39
R7987:Vmn2r50 UTSW 7 9,772,016 (GRCm39) missense probably benign 0.14
R7996:Vmn2r50 UTSW 7 9,781,795 (GRCm39) missense probably damaging 0.99
R8062:Vmn2r50 UTSW 7 9,774,240 (GRCm39) critical splice donor site probably null
R8396:Vmn2r50 UTSW 7 9,781,639 (GRCm39) nonsense probably null
R8466:Vmn2r50 UTSW 7 9,783,997 (GRCm39) missense probably damaging 0.97
R8985:Vmn2r50 UTSW 7 9,779,974 (GRCm39) missense probably damaging 1.00
R9068:Vmn2r50 UTSW 7 9,772,061 (GRCm39) missense possibly damaging 0.46
R9155:Vmn2r50 UTSW 7 9,781,571 (GRCm39) missense probably damaging 1.00
R9238:Vmn2r50 UTSW 7 9,781,503 (GRCm39) missense probably benign 0.01
R9576:Vmn2r50 UTSW 7 9,771,190 (GRCm39) missense probably benign
R9626:Vmn2r50 UTSW 7 9,771,960 (GRCm39) nonsense probably null
R9631:Vmn2r50 UTSW 7 9,786,990 (GRCm39) nonsense probably null
X0067:Vmn2r50 UTSW 7 9,786,954 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 9,780,086 (GRCm39) missense probably benign 0.01
Z1088:Vmn2r50 UTSW 7 9,771,427 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTTCAGACTTAGCAACAGGAC -3'
(R):5'- ATGCAATAAACCTCACCTTTGC -3'

Sequencing Primer
(F):5'- TCAGACTTAGCAACAGGACAGAAGTC -3'
(R):5'- TTGCACAAAGAAATAAATGCAAGC -3'
Posted On 2018-08-29