Incidental Mutation 'R6762:Vmn2r50'
ID 531738
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Name vomeronasal 2, receptor 50
Synonyms EG434117
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 10037235-10053178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10053083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 32 (N32K)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
AlphaFold E9PW61
Predicted Effect probably benign
Transcript: ENSMUST00000074943
AA Change: N32K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: N32K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086298
AA Change: N32K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: N32K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 10037683 missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 10037437 missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 10047787 missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 10050325 missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 10037441 missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 10046002 missense probably damaging 0.99
PIT4651001:Vmn2r50 UTSW 7 10037732 missense probably benign 0.30
R0530:Vmn2r50 UTSW 7 10047717 missense possibly damaging 0.82
R1291:Vmn2r50 UTSW 7 10037477 missense probably damaging 0.98
R1438:Vmn2r50 UTSW 7 10050135 nonsense probably null
R1713:Vmn2r50 UTSW 7 10037804 missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 10047678 missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 10052988 missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 10047683 missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 10053099 missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 10047713 missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 10037924 missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 10040382 missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 10052995 missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 10047907 missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4413:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 10037235 makesense probably null
R5151:Vmn2r50 UTSW 7 10053043 missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 10047825 missense probably damaging 1.00
R5457:Vmn2r50 UTSW 7 10047946 missense probably damaging 0.98
R5559:Vmn2r50 UTSW 7 10037326 missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 10050089 missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 10040372 missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 10047978 missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 10050059 missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 10040326 missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R6995:Vmn2r50 UTSW 7 10046037 nonsense probably null
R6998:Vmn2r50 UTSW 7 10037757 missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 10050245 missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 10047612 missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 10050350 critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 10050139 missense probably null 0.00
R7704:Vmn2r50 UTSW 7 10047738 missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 10037371 missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 10037635 missense possibly damaging 0.70
R7975:Vmn2r50 UTSW 7 10037345 missense probably benign 0.39
R7987:Vmn2r50 UTSW 7 10038089 missense probably benign 0.14
R7996:Vmn2r50 UTSW 7 10047868 missense probably damaging 0.99
R8062:Vmn2r50 UTSW 7 10040313 critical splice donor site probably null
R8396:Vmn2r50 UTSW 7 10047712 nonsense probably null
R8466:Vmn2r50 UTSW 7 10050070 missense probably damaging 0.97
R8985:Vmn2r50 UTSW 7 10046047 missense probably damaging 1.00
R9068:Vmn2r50 UTSW 7 10038134 missense possibly damaging 0.46
R9155:Vmn2r50 UTSW 7 10047644 missense probably damaging 1.00
R9238:Vmn2r50 UTSW 7 10047576 missense probably benign 0.01
R9576:Vmn2r50 UTSW 7 10037263 missense probably benign
R9626:Vmn2r50 UTSW 7 10038033 nonsense probably null
R9631:Vmn2r50 UTSW 7 10053063 nonsense probably null
X0067:Vmn2r50 UTSW 7 10053027 missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 10037500 missense possibly damaging 0.91
Z1088:Vmn2r50 UTSW 7 10046159 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCAGACTTAGCAACAGGAC -3'
(R):5'- ATGCAATAAACCTCACCTTTGC -3'

Sequencing Primer
(F):5'- TCAGACTTAGCAACAGGACAGAAGTC -3'
(R):5'- TTGCACAAAGAAATAAATGCAAGC -3'
Posted On 2018-08-29