Incidental Mutation 'R6762:Cyp2s1'
ID531740
Institutional Source Beutler Lab
Gene Symbol Cyp2s1
Ensembl Gene ENSMUSG00000040703
Gene Namecytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms1200011C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6762 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25802475-25816913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25808070 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 318 (L318H)
Ref Sequence ENSEMBL: ENSMUSP00000104032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]
Predicted Effect probably damaging
Transcript: ENSMUST00000043314
AA Change: L318H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703
AA Change: L318H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 493 6.4e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108395
AA Change: L318H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703
AA Change: L318H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 440 4e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156714
SMART Domains Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
Pfam:p450 1 91 1.2e-13 PFAM
Meta Mutation Damage Score 0.8460 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Cyp2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Cyp2s1 APN 7 25809258 missense probably damaging 1.00
IGL02415:Cyp2s1 APN 7 25808137 missense probably damaging 1.00
IGL02530:Cyp2s1 APN 7 25816424 unclassified probably benign
IGL02927:Cyp2s1 APN 7 25808152 missense probably benign 0.17
IGL03358:Cyp2s1 APN 7 25808148 missense probably damaging 1.00
R0139:Cyp2s1 UTSW 7 25811689 utr 5 prime probably null
R0523:Cyp2s1 UTSW 7 25806050 missense probably damaging 1.00
R0650:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0652:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0723:Cyp2s1 UTSW 7 25809548 missense probably benign 0.01
R1086:Cyp2s1 UTSW 7 25805997 missense probably damaging 1.00
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3733:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3813:Cyp2s1 UTSW 7 25805866 splice site probably null
R3958:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R4593:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R4965:Cyp2s1 UTSW 7 25809285 missense possibly damaging 0.85
R5278:Cyp2s1 UTSW 7 25805884 missense possibly damaging 0.95
R5642:Cyp2s1 UTSW 7 25816319 splice site probably null
R6258:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R6628:Cyp2s1 UTSW 7 25815041 missense probably benign 0.02
R7367:Cyp2s1 UTSW 7 25805973 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGTCTTGCACTGTGATCAGAAG -3'
(R):5'- TGGGAGTAATGACCAATGGC -3'

Sequencing Primer
(F):5'- TCAGAAGTTCTGGAAGCCCTGAC -3'
(R):5'- AATGTCTGTGACTTCAAGGCCAG -3'
Posted On2018-08-29