Incidental Mutation 'R6762:Sptbn4'
ID531741
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R6762 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27394208 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1340 (F1340L)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: F1345L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: F1345L

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: F25L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: F25L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: F25L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: F25L

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: F1340L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: F1340L

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Meta Mutation Damage Score 0.3884 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27366689 missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27375590 missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27372272 missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27364336 missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27361634 missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27362410 missense probably benign
R8002:Sptbn4 UTSW 7 27417992 missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27364269 missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27375383 missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27408889 nonsense probably null
R8353:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27372296 missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27404238 missense probably damaging 1.00
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Z1176:Sptbn4 UTSW 7 27360025 missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27404582 missense probably damaging 1.00
Z1177:Sptbn4 UTSW 7 27409102 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTTGAACCCAGGGTTTCCC -3'
(R):5'- AACCTGAAGTTCTTGAGGGG -3'

Sequencing Primer
(F):5'- CCCTTGTACAGATGGGCAAACTG -3'
(R):5'- CCTGAAGTTCTTGAGGGGTGTTTTG -3'
Posted On2018-08-29