Incidental Mutation 'R6762:Fanca'
ID 531744
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene Name Fanconi anemia, complementation group A
Synonyms
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.714) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 123995039-124045315 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 123998042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1215 (A1215S)
Ref Sequence ENSEMBL: ENSMUSP00000045217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664]
AlphaFold Q9JL70
Predicted Effect probably benign
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035495
AA Change: A1215S

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: A1215S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213090
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 124,032,002 (GRCm39) missense probably damaging 1.00
IGL02805:Fanca APN 8 124,016,233 (GRCm39) missense probably damaging 0.99
IGL03280:Fanca APN 8 124,043,198 (GRCm39) unclassified probably benign
PIT4402001:Fanca UTSW 8 124,039,803 (GRCm39) missense possibly damaging 0.83
R0114:Fanca UTSW 8 124,015,230 (GRCm39) splice site probably null
R0115:Fanca UTSW 8 123,995,278 (GRCm39) missense probably benign 0.00
R0271:Fanca UTSW 8 123,999,180 (GRCm39) unclassified probably benign
R0330:Fanca UTSW 8 124,000,911 (GRCm39) nonsense probably null
R0345:Fanca UTSW 8 124,031,552 (GRCm39) missense probably damaging 1.00
R0570:Fanca UTSW 8 124,033,169 (GRCm39) missense probably benign 0.01
R0601:Fanca UTSW 8 124,035,252 (GRCm39) missense probably damaging 0.99
R0617:Fanca UTSW 8 124,014,809 (GRCm39) missense probably damaging 0.99
R0639:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R0943:Fanca UTSW 8 124,000,925 (GRCm39) missense probably damaging 1.00
R1140:Fanca UTSW 8 124,039,868 (GRCm39) splice site probably null
R1364:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1366:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1367:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1368:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1969:Fanca UTSW 8 124,014,803 (GRCm39) missense probably benign 0.41
R1992:Fanca UTSW 8 124,024,551 (GRCm39) missense possibly damaging 0.94
R2060:Fanca UTSW 8 124,001,220 (GRCm39) missense probably damaging 1.00
R2174:Fanca UTSW 8 123,998,009 (GRCm39) missense probably benign 0.00
R2261:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R3957:Fanca UTSW 8 124,043,102 (GRCm39) missense probably benign 0.00
R4062:Fanca UTSW 8 124,001,911 (GRCm39) missense probably benign 0.00
R4153:Fanca UTSW 8 124,031,617 (GRCm39) missense possibly damaging 0.89
R4270:Fanca UTSW 8 123,995,533 (GRCm39) missense probably damaging 1.00
R4424:Fanca UTSW 8 124,015,532 (GRCm39) missense probably benign 0.11
R4581:Fanca UTSW 8 124,001,077 (GRCm39) splice site probably null
R4639:Fanca UTSW 8 124,044,889 (GRCm39) missense probably damaging 0.98
R4664:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4665:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4666:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4686:Fanca UTSW 8 123,995,673 (GRCm39) splice site probably benign
R4775:Fanca UTSW 8 124,023,045 (GRCm39) missense probably damaging 0.99
R4782:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4799:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4926:Fanca UTSW 8 124,030,724 (GRCm39) missense probably benign 0.05
R4973:Fanca UTSW 8 124,035,261 (GRCm39) missense probably damaging 0.96
R5039:Fanca UTSW 8 124,010,785 (GRCm39) missense probably benign
R5195:Fanca UTSW 8 124,030,684 (GRCm39) intron probably benign
R5590:Fanca UTSW 8 124,030,702 (GRCm39) intron probably benign
R5848:Fanca UTSW 8 124,021,792 (GRCm39) intron probably benign
R5965:Fanca UTSW 8 124,043,149 (GRCm39) missense possibly damaging 0.46
R6224:Fanca UTSW 8 124,032,020 (GRCm39) missense possibly damaging 0.87
R6385:Fanca UTSW 8 124,032,606 (GRCm39) splice site probably null
R6795:Fanca UTSW 8 124,045,232 (GRCm39) missense probably benign 0.02
R6810:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.99
R7153:Fanca UTSW 8 124,043,164 (GRCm39) missense probably damaging 1.00
R7170:Fanca UTSW 8 123,997,945 (GRCm39) missense probably damaging 1.00
R7204:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.98
R7366:Fanca UTSW 8 124,007,952 (GRCm39) missense probably benign 0.08
R7599:Fanca UTSW 8 123,997,999 (GRCm39) missense probably benign
R7639:Fanca UTSW 8 124,018,134 (GRCm39) critical splice donor site probably null
R7650:Fanca UTSW 8 123,995,303 (GRCm39) splice site probably null
R8066:Fanca UTSW 8 124,030,679 (GRCm39) missense unknown
R8247:Fanca UTSW 8 124,010,694 (GRCm39) unclassified probably benign
R8312:Fanca UTSW 8 123,996,549 (GRCm39) intron probably benign
R8327:Fanca UTSW 8 124,039,984 (GRCm39) nonsense probably null
R8719:Fanca UTSW 8 124,014,867 (GRCm39) missense probably benign 0.00
R8826:Fanca UTSW 8 123,995,209 (GRCm39) missense probably benign 0.07
R8987:Fanca UTSW 8 124,024,538 (GRCm39) missense probably damaging 1.00
R9017:Fanca UTSW 8 124,035,307 (GRCm39) missense possibly damaging 0.69
R9319:Fanca UTSW 8 124,018,190 (GRCm39) missense probably benign
R9471:Fanca UTSW 8 124,000,897 (GRCm39) missense possibly damaging 0.88
R9542:Fanca UTSW 8 124,023,078 (GRCm39) missense probably damaging 0.98
R9656:Fanca UTSW 8 124,031,482 (GRCm39) missense probably benign 0.02
R9708:Fanca UTSW 8 124,001,263 (GRCm39) nonsense probably null
V7732:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
X0025:Fanca UTSW 8 124,003,287 (GRCm39) intron probably benign
X0062:Fanca UTSW 8 124,031,591 (GRCm39) missense possibly damaging 0.95
Z1177:Fanca UTSW 8 124,039,368 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCTCACAGTGTGGACAC -3'
(R):5'- ACTTACGTACAGGGATGGCC -3'

Sequencing Primer
(F):5'- ACACTGGCTGGTAGCTTTATTCTAAG -3'
(R):5'- ATGGCCCCACCTATCAGG -3'
Posted On 2018-08-29