Incidental Mutation 'R6762:Qtrt1'
ID531745
Institutional Source Beutler Lab
Gene Symbol Qtrt1
Ensembl Gene ENSMUSG00000002825
Gene Namequeuine tRNA-ribosyltransferase catalytic subunit 1
SynonymsTgt, tRNA-guanine transglycosylase, 2610028E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R6762 (G1)
Quality Score200.009
Status Validated
Chromosome9
Chromosomal Location21411837-21420274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21412082 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 76 (H76Q)
Ref Sequence ENSEMBL: ENSMUSP00000002902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002902] [ENSMUST00000214681] [ENSMUST00000216527]
Predicted Effect probably damaging
Transcript: ENSMUST00000002902
AA Change: H76Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002902
Gene: ENSMUSG00000002825
AA Change: H76Q

DomainStartEndE-ValueType
Pfam:TGT 142 376 1.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213718
Predicted Effect probably benign
Transcript: ENSMUST00000214681
Predicted Effect probably benign
Transcript: ENSMUST00000216277
Predicted Effect unknown
Transcript: ENSMUST00000216527
AA Change: S33T
Meta Mutation Damage Score 0.9447 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine and tyrosine. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice heterozygous or homozygous for a gene trap allele exhibit reduced phenylalanine conversion to tyrosine and reduced cell levels of queuosine-modified tRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Qtrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Qtrt1 APN 9 21419549 critical splice donor site probably null
IGL02048:Qtrt1 APN 9 21417355 missense probably damaging 1.00
IGL02217:Qtrt1 APN 9 21417389 critical splice donor site probably null
IGL02299:Qtrt1 APN 9 21411949 missense probably benign 0.06
R0496:Qtrt1 UTSW 9 21419548 missense probably benign 0.09
R0625:Qtrt1 UTSW 9 21418288 missense probably benign 0.43
R1173:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1174:Qtrt1 UTSW 9 21412486 missense probably benign 0.05
R1250:Qtrt1 UTSW 9 21419548 missense probably benign 0.09
R1563:Qtrt1 UTSW 9 21419311 missense probably benign 0.44
R3791:Qtrt1 UTSW 9 21419340 missense probably damaging 1.00
R4997:Qtrt1 UTSW 9 21417358 missense probably benign 0.00
R6057:Qtrt1 UTSW 9 21412003 missense probably damaging 1.00
R7422:Qtrt1 UTSW 9 21412457 missense probably benign 0.00
R7881:Qtrt1 UTSW 9 21419341 missense probably damaging 1.00
R7964:Qtrt1 UTSW 9 21419341 missense probably damaging 1.00
R8077:Qtrt1 UTSW 9 21420096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAATAATGCGGCTGGTCG -3'
(R):5'- CAGATTGTGGGGCCAATTCATG -3'

Sequencing Primer
(F):5'- CTGGTCGCTGAGTGCAGTC -3'
(R):5'- TTCATGAAGCCGTGAAGACCCTG -3'
Posted On2018-08-29