Incidental Mutation 'R6762:Ackr4'
ID531746
Institutional Source Beutler Lab
Gene Symbol Ackr4
Ensembl Gene ENSMUSG00000079355
Gene Nameatypical chemokine receptor 4
SynonymsPPR1, CCBP2, CCR11, VSHK1, A630091E18Rik, CCX-CKR, Ccrl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6762 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104084157-104126933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104099668 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 27 (Y27H)
Ref Sequence ENSEMBL: ENSMUSP00000152036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047799] [ENSMUST00000076147] [ENSMUST00000120854] [ENSMUST00000188000] [ENSMUST00000189998] [ENSMUST00000219146]
Predicted Effect probably benign
Transcript: ENSMUST00000047799
SMART Domains Protein: ENSMUSP00000043424
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 43 307 3.5e-45 PFAM
Pfam:Acyl-CoA_dh_N 376 498 1.5e-13 PFAM
Pfam:Acyl-CoA_dh_M 502 605 1.7e-21 PFAM
Pfam:Acyl-CoA_dh_1 617 768 2.7e-36 PFAM
Pfam:Acyl-CoA_dh_2 632 743 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076147
AA Change: Y27H

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075507
Gene: ENSMUSG00000079355
AA Change: Y27H

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Pfam:7tm_1 58 303 8.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120854
SMART Domains Protein: ENSMUSP00000112994
Gene: ENSMUSG00000090150

DomainStartEndE-ValueType
Pfam:APH 1 188 1.1e-28 PFAM
Pfam:EcKinase 49 143 4.8e-9 PFAM
Pfam:Acyl-CoA_dh_N 257 380 8.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 385 439 2.4e-19 PFAM
Pfam:Acyl-CoA_dh_1 499 650 1.3e-37 PFAM
Pfam:Acyl-CoA_dh_2 514 632 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188000
AA Change: Y27H

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140792
Gene: ENSMUSG00000079355
AA Change: Y27H

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
Pfam:7tm_1 58 303 5.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189998
Predicted Effect probably benign
Transcript: ENSMUST00000219146
AA Change: Y27H

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0790 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family, and is a receptor for C-C type chemokines. This receptor has been shown to bind dendritic cell- and T cell-activated chemokines including CCL19/ELC, CCL21/SLC, and CCL25/TECK. A pseudogene of this gene is found on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. Mice homozygous for a different knock-out allele exhibit increased susceptibility to experimental autoimmune encephalomyelitis with increased Th17 response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Ackr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Ackr4 APN 9 104085931 intron probably benign
IGL01859:Ackr4 APN 9 104086137 intron probably benign
IGL02088:Ackr4 APN 9 104098881 missense probably damaging 0.99
R0108:Ackr4 UTSW 9 104099188 missense probably benign 0.07
R0194:Ackr4 UTSW 9 104099480 missense probably benign 0.31
R0208:Ackr4 UTSW 9 104099661 missense probably benign
R0519:Ackr4 UTSW 9 104099451 missense probably benign 0.02
R0594:Ackr4 UTSW 9 104099004 missense possibly damaging 0.55
R0940:Ackr4 UTSW 9 104099632 missense probably damaging 1.00
R4510:Ackr4 UTSW 9 104098731 missense probably benign 0.02
R4511:Ackr4 UTSW 9 104098731 missense probably benign 0.02
R5298:Ackr4 UTSW 9 104098887 missense possibly damaging 0.91
R5961:Ackr4 UTSW 9 104099139 missense probably damaging 1.00
R6402:Ackr4 UTSW 9 104098945 missense possibly damaging 0.95
R7080:Ackr4 UTSW 9 104099562 missense probably damaging 1.00
R8218:Ackr4 UTSW 9 104099211 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCCAGGTTCAGGATGTACAC -3'
(R):5'- CCAACATGTGAGAGCTAGGC -3'

Sequencing Primer
(F):5'- GATGTACACATCGGTCTTGGTCC -3'
(R):5'- AGCTAGGCTCACACATGTG -3'
Posted On2018-08-29