Incidental Mutation 'R6762:Taar2'
ID531747
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Nametrace amine-associated receptor 2
SynonymsGpr58
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6762 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23938572-23941583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23941402 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 280 (T280M)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
Predicted Effect probably damaging
Transcript: ENSMUST00000079134
AA Change: T280M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: T280M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23941368 missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23940675 missense probably benign 0.00
IGL01346:Taar2 APN 10 23941099 missense probably damaging 1.00
IGL01433:Taar2 APN 10 23940759 missense probably benign 0.02
IGL01782:Taar2 APN 10 23941144 missense probably damaging 1.00
IGL03106:Taar2 APN 10 23941297 missense probably damaging 0.99
IGL03372:Taar2 APN 10 23941171 missense probably benign 0.03
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0046:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0090:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0101:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0103:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0157:Taar2 UTSW 10 23941491 missense probably damaging 1.00
R0189:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0190:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0226:Taar2 UTSW 10 23941063 missense probably damaging 1.00
R0226:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0265:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0267:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0349:Taar2 UTSW 10 23941429 missense possibly damaging 0.79
R0349:Taar2 UTSW 10 23941509 missense probably benign 0.01
R0426:Taar2 UTSW 10 23941495 missense probably benign 0.00
R0556:Taar2 UTSW 10 23940895 missense probably damaging 1.00
R0698:Taar2 UTSW 10 23941495 missense probably benign 0.00
R1191:Taar2 UTSW 10 23941029 missense probably damaging 1.00
R2919:Taar2 UTSW 10 23941556 missense probably benign 0.00
R4615:Taar2 UTSW 10 23941365 missense probably benign 0.43
R4658:Taar2 UTSW 10 23941503 missense probably benign 0.04
R4766:Taar2 UTSW 10 23940771 missense probably damaging 0.98
R4872:Taar2 UTSW 10 23940693 missense probably benign 0.02
R5205:Taar2 UTSW 10 23940976 missense probably benign 0.42
R5271:Taar2 UTSW 10 23941032 missense probably damaging 0.97
R5517:Taar2 UTSW 10 23940729 missense possibly damaging 0.92
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6033:Taar2 UTSW 10 23940976 missense probably benign
R6325:Taar2 UTSW 10 23940717 missense probably benign 0.05
R6398:Taar2 UTSW 10 23941279 missense probably benign 0.00
R7121:Taar2 UTSW 10 23940827 missense probably damaging 1.00
R7209:Taar2 UTSW 10 23940699 missense possibly damaging 0.57
R7709:Taar2 UTSW 10 23940723 missense probably benign 0.00
R8045:Taar2 UTSW 10 23941488 missense probably damaging 1.00
R8223:Taar2 UTSW 10 23941350 missense probably damaging 1.00
Z1176:Taar2 UTSW 10 23941186 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGGCAAAATTTTCGCTGTATCC -3'
(R):5'- AGTGCCAGTCGTTGATGAC -3'

Sequencing Primer
(F):5'- ACGCTCGCGTAATTGAC -3'
(R):5'- GTCGTTGATGACTAGTACAGATCAAG -3'
Posted On2018-08-29