Incidental Mutation 'R6762:Taar2'
ID 531747
Institutional Source Beutler Lab
Gene Symbol Taar2
Ensembl Gene ENSMUSG00000059763
Gene Name trace amine-associated receptor 2
Synonyms Gpr58
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 23814470-23817481 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23817300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 280 (T280M)
Ref Sequence ENSEMBL: ENSMUSP00000078137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079134]
AlphaFold Q5QD17
Predicted Effect probably damaging
Transcript: ENSMUST00000079134
AA Change: T280M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078137
Gene: ENSMUSG00000059763
AA Change: T280M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 318 2.4e-10 PFAM
Pfam:7tm_1 48 303 2.9e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Taar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Taar2 APN 10 23,817,266 (GRCm39) missense possibly damaging 0.50
IGL00807:Taar2 APN 10 23,816,573 (GRCm39) missense probably benign 0.00
IGL01346:Taar2 APN 10 23,816,997 (GRCm39) missense probably damaging 1.00
IGL01433:Taar2 APN 10 23,816,657 (GRCm39) missense probably benign 0.02
IGL01782:Taar2 APN 10 23,817,042 (GRCm39) missense probably damaging 1.00
IGL03106:Taar2 APN 10 23,817,195 (GRCm39) missense probably damaging 0.99
IGL03372:Taar2 APN 10 23,817,069 (GRCm39) missense probably benign 0.03
R0046:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0046:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0090:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0101:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0101:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0103:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0157:Taar2 UTSW 10 23,817,389 (GRCm39) missense probably damaging 1.00
R0189:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0190:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0226:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0226:Taar2 UTSW 10 23,816,961 (GRCm39) missense probably damaging 1.00
R0265:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0267:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0349:Taar2 UTSW 10 23,817,407 (GRCm39) missense probably benign 0.01
R0349:Taar2 UTSW 10 23,817,327 (GRCm39) missense possibly damaging 0.79
R0426:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R0556:Taar2 UTSW 10 23,816,793 (GRCm39) missense probably damaging 1.00
R0698:Taar2 UTSW 10 23,817,393 (GRCm39) missense probably benign 0.00
R1191:Taar2 UTSW 10 23,816,927 (GRCm39) missense probably damaging 1.00
R2919:Taar2 UTSW 10 23,817,454 (GRCm39) missense probably benign 0.00
R4615:Taar2 UTSW 10 23,817,263 (GRCm39) missense probably benign 0.43
R4658:Taar2 UTSW 10 23,817,401 (GRCm39) missense probably benign 0.04
R4766:Taar2 UTSW 10 23,816,669 (GRCm39) missense probably damaging 0.98
R4872:Taar2 UTSW 10 23,816,591 (GRCm39) missense probably benign 0.02
R5205:Taar2 UTSW 10 23,816,874 (GRCm39) missense probably benign 0.42
R5271:Taar2 UTSW 10 23,816,930 (GRCm39) missense probably damaging 0.97
R5517:Taar2 UTSW 10 23,816,627 (GRCm39) missense possibly damaging 0.92
R6033:Taar2 UTSW 10 23,816,874 (GRCm39) missense probably benign
R6033:Taar2 UTSW 10 23,816,874 (GRCm39) missense probably benign
R6325:Taar2 UTSW 10 23,816,615 (GRCm39) missense probably benign 0.05
R6398:Taar2 UTSW 10 23,817,177 (GRCm39) missense probably benign 0.00
R7121:Taar2 UTSW 10 23,816,725 (GRCm39) missense probably damaging 1.00
R7209:Taar2 UTSW 10 23,816,597 (GRCm39) missense possibly damaging 0.57
R7709:Taar2 UTSW 10 23,816,621 (GRCm39) missense probably benign 0.00
R8045:Taar2 UTSW 10 23,817,386 (GRCm39) missense probably damaging 1.00
R8223:Taar2 UTSW 10 23,817,248 (GRCm39) missense probably damaging 1.00
R8743:Taar2 UTSW 10 23,817,369 (GRCm39) missense probably damaging 1.00
R9307:Taar2 UTSW 10 23,817,237 (GRCm39) missense probably damaging 1.00
R9350:Taar2 UTSW 10 23,817,345 (GRCm39) missense probably damaging 1.00
R9351:Taar2 UTSW 10 23,816,900 (GRCm39) missense probably benign 0.14
R9755:Taar2 UTSW 10 23,817,038 (GRCm39) missense probably damaging 1.00
Z1176:Taar2 UTSW 10 23,817,084 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGGCAAAATTTTCGCTGTATCC -3'
(R):5'- AGTGCCAGTCGTTGATGAC -3'

Sequencing Primer
(F):5'- ACGCTCGCGTAATTGAC -3'
(R):5'- GTCGTTGATGACTAGTACAGATCAAG -3'
Posted On 2018-08-29