Incidental Mutation 'R6762:Prep'
ID 531748
Institutional Source Beutler Lab
Gene Symbol Prep
Ensembl Gene ENSMUSG00000019849
Gene Name prolyl endopeptidase
Synonyms prolyl oligopeptidase, Pop, D10Wsu136e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 45067203-45167198 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 45148123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099858]
AlphaFold Q9QUR6
Predicted Effect probably null
Transcript: ENSMUST00000099858
SMART Domains Protein: ENSMUSP00000097444
Gene: ENSMUSG00000019849

DomainStartEndE-ValueType
Pfam:Peptidase_S9_N 7 423 1.2e-170 PFAM
Pfam:Peptidase_S9 482 707 1.7e-72 PFAM
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit sex-dependent resistance to diet-induced obesity and adiposity. Mice heterozygous for a gene trap allele exhibit maternal inheritance influenced increase in body weight, organ weight, and adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Prep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prep APN 10 45115173 missense probably damaging 1.00
IGL01412:Prep APN 10 45153112 missense probably damaging 1.00
IGL01577:Prep APN 10 45072048 splice site probably benign
IGL02751:Prep APN 10 45115186 missense probably damaging 1.00
IGL02754:Prep APN 10 45067332 start codon destroyed probably null 0.23
IGL02875:Prep APN 10 45158433 missense probably damaging 1.00
IGL02957:Prep APN 10 45126030 missense probably benign 0.44
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0008:Prep UTSW 10 45115078 missense probably benign 0.17
R0167:Prep UTSW 10 45158230 critical splice acceptor site probably null
R0396:Prep UTSW 10 45092676 missense probably damaging 1.00
R0828:Prep UTSW 10 45155525 missense probably benign 0.01
R1309:Prep UTSW 10 45126026 missense probably benign
R2166:Prep UTSW 10 45092655 splice site probably benign
R4020:Prep UTSW 10 45092798 splice site probably benign
R4058:Prep UTSW 10 45158371 missense probably benign 0.29
R4162:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4163:Prep UTSW 10 45067340 missense probably benign
R4163:Prep UTSW 10 45067362 missense possibly damaging 0.96
R4328:Prep UTSW 10 45120649 missense probably benign
R4343:Prep UTSW 10 45120770 missense probably damaging 0.99
R4493:Prep UTSW 10 45120819 missense probably benign 0.38
R4495:Prep UTSW 10 45120819 missense probably benign 0.38
R5192:Prep UTSW 10 45153111 missense probably benign 0.28
R5569:Prep UTSW 10 45097437 missense probably benign
R5888:Prep UTSW 10 45067364 missense possibly damaging 0.74
R5999:Prep UTSW 10 45072129 critical splice donor site probably null
R6468:Prep UTSW 10 45115107 missense probably damaging 1.00
R6556:Prep UTSW 10 45158314 frame shift probably null
R6696:Prep UTSW 10 45153078 missense probably damaging 1.00
R6737:Prep UTSW 10 45097495 missense possibly damaging 0.62
R6830:Prep UTSW 10 45097501 missense probably benign 0.01
R7105:Prep UTSW 10 45126063 missense probably benign
R7193:Prep UTSW 10 45092699 missense probably benign 0.00
R7466:Prep UTSW 10 45150438 missense probably benign 0.32
R7492:Prep UTSW 10 45120814 missense probably damaging 1.00
R7553:Prep UTSW 10 45158524 makesense probably null
R7860:Prep UTSW 10 45091012 missense probably damaging 1.00
R8544:Prep UTSW 10 45153127 missense probably damaging 1.00
R8808:Prep UTSW 10 45095156 nonsense probably null
R8894:Prep UTSW 10 45158524 makesense probably null
R9055:Prep UTSW 10 45115195 missense probably benign 0.01
R9316:Prep UTSW 10 45091096 missense probably damaging 1.00
R9488:Prep UTSW 10 45120711 missense
Z1176:Prep UTSW 10 45150468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTCTAAAACTGTGCACC -3'
(R):5'- AAAACCTATCCTGATGTGGGC -3'

Sequencing Primer
(F):5'- CACGTGGCGCTGTATGTAAC -3'
(R):5'- CCCTCTATGAAATGCCAC -3'
Posted On 2018-08-29