Incidental Mutation 'R6762:Olfr780'
ID 531750
Institutional Source Beutler Lab
Gene Symbol Olfr780
Ensembl Gene ENSMUSG00000049573
Gene Name olfactory receptor 780
Synonyms GA_x6K02T2PULF-11002360-11003298, MOR114-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129318117-129324141 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129322256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 211 (C211Y)
Ref Sequence ENSEMBL: ENSMUSP00000149258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063168] [ENSMUST00000215503]
AlphaFold Q8VEU0
Predicted Effect probably damaging
Transcript: ENSMUST00000063168
AA Change: C211Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054927
Gene: ENSMUSG00000049573
AA Change: C211Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.4e-45 PFAM
Pfam:7tm_1 39 288 9.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215503
AA Change: C211Y

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.2289 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Rpa1 T A 11: 75,340,345 S73C possibly damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Olfr780
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr780 APN 10 129321716 missense probably benign 0.00
IGL02817:Olfr780 APN 10 129321895 missense probably benign 0.01
IGL03121:Olfr780 APN 10 129322168 missense probably benign 0.11
IGL03396:Olfr780 APN 10 129322047 missense probably benign 0.01
R0586:Olfr780 UTSW 10 129322047 missense probably benign 0.01
R0601:Olfr780 UTSW 10 129322016 missense possibly damaging 0.52
R1957:Olfr780 UTSW 10 129321871 missense possibly damaging 0.95
R3915:Olfr780 UTSW 10 129322309 missense probably benign 0.14
R4419:Olfr780 UTSW 10 129321815 missense possibly damaging 0.95
R5383:Olfr780 UTSW 10 129322336 missense probably damaging 1.00
R6030:Olfr780 UTSW 10 129322369 missense probably benign 0.02
R6030:Olfr780 UTSW 10 129322369 missense probably benign 0.02
R7259:Olfr780 UTSW 10 129321794 missense probably benign 0.13
R7575:Olfr780 UTSW 10 129321859 missense probably damaging 1.00
R7904:Olfr780 UTSW 10 129321796 missense probably damaging 1.00
R8933:Olfr780 UTSW 10 129322390 missense probably damaging 0.98
R9130:Olfr780 UTSW 10 129322028 missense probably benign 0.00
R9529:Olfr780 UTSW 10 129322336 missense probably damaging 1.00
Z1176:Olfr780 UTSW 10 129322219 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCATCATGAACAACAAGGTGTG -3'
(R):5'- ACCGCTTCTTTTGCAGACG -3'

Sequencing Primer
(F):5'- GGATGGCAGCATTCATGATTATCCTC -3'
(R):5'- CGGTTTGACGTAGATGAAGATGC -3'
Posted On 2018-08-29