Mutagenetix > Incidental Mutation

Incidental Mutation 'R6762:Wdpcp'

531751

Institutional Source

Beutler Lab

Gene Symbol

Wdpcp

Ensembl Gene

ENSMUSG00000020319

Gene Name

WD repeat containing planar cell polarity effector

Synonyms

AV249152, homoloc-13

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R6762 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21572235-21898989 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21721244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 495 (T495I)

Ref Sequence

ENSEMBL: ENSMUSP00000020568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020568]

AlphaFold

Q8C456

Predicted Effect

probably benign
Transcript: ENSMUST00000020568
AA Change: T495I

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020568
Gene: ENSMUSG00000020319
AA Change: T495I

Domain	Start	End	E-Value	Type
Pfam:DUF3312	48	591	4.4e-278	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic WD40 repeat protein. A similar gene in frogs encodes a planar cell polarity protein that plays a critical role in collective cell movement and ciliogenesis by mediating septin localization. Mutations in this gene are associated with Bardet-Biedl syndrome 15 and may also play a role in Meckel-Gruber syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a null mutation display ciliogenesis defects, anophthalmia, cysts in multiple tissues, central polydactyly, duplex kidney, and septation defects in the outflow tract and cloaca. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr4	A	G	9: 104,099,668	Y27H	probably benign	Het
Angptl3	T	A	4: 99,037,417	S327T	possibly damaging	Het
Arl6ip4	GGAAGAAGAAGAAGAAGAA	GGAAGAAGAAGAAGAAGAAGAA	5: 124,117,050		probably benign	Het
Cyp2s1	A	T	7: 25,808,070	L318H	probably damaging	Het
Dnah14	T	C	1: 181,757,259	L3185P	probably damaging	Het
Dnah7b	T	C	1: 46,224,742	V2128A	probably benign	Het
Ehhadh	A	T	16: 21,762,459	F594L	probably benign	Het
En2	A	G	5: 28,170,353	N298S	possibly damaging	Het
Epha5	T	A	5: 84,331,726	N140Y	probably damaging	Het
Fam151b	C	T	13: 92,468,050	V144I	possibly damaging	Het
Fanca	C	A	8: 123,271,303	A1215S	probably benign	Het
Fancd2	T	A	6: 113,586,016		probably null	Het
Fat2	T	C	11: 55,253,482		probably null	Het
Gm4513	T	C	7: 20,594,193	N31S	probably benign	Het
Hspg2	A	T	4: 137,551,803	I3066F	possibly damaging	Het
Krt10	T	C	11: 99,387,057	T355A	possibly damaging	Het
Lims1	C	A	10: 58,412,545	H275N	probably damaging	Het
Map3k19	C	T	1: 127,847,264	G112D	probably damaging	Het
Mdn1	T	A	4: 32,676,786	N619K	possibly damaging	Het
Mpp6	T	A	6: 50,180,438		probably null	Het
Mtor	A	G	4: 148,538,481	T1977A	possibly damaging	Het
Nos2	T	G	11: 78,959,748	L1144R	possibly damaging	Het
Olfr1085	A	T	2: 86,657,844	F205I	probably benign	Het
Olfr608	G	C	7: 103,470,389	V117L	probably benign	Het
Olfr780	G	A	10: 129,322,256	C211Y	probably damaging	Het
Pcdhga9	C	A	18: 37,737,268	S50Y	probably damaging	Het
Pfn4	T	A	12: 4,775,487	M108K	probably damaging	Het
Prep	T	C	10: 45,148,123		probably null	Het
Qtrt1	T	A	9: 21,412,082	H76Q	probably damaging	Het
Rpa1	T	A	11: 75,340,345	S73C	possibly damaging	Het
Senp5	A	G	16: 31,989,884	V157A	probably damaging	Het
Snapc3	T	C	4: 83,435,258	L178P	probably damaging	Het
Sptbn4	A	G	7: 27,394,208	F1340L	probably damaging	Het
Srd5a3	T	A	5: 76,153,551	I85K	probably benign	Het
Taar2	C	T	10: 23,941,402	T280M	probably damaging	Het
Tgfb3	T	C	12: 86,069,463	D177G	probably benign	Het
Tpt1	A	G	14: 75,846,381	D94G	probably benign	Het
Trpm4	A	G	7: 45,304,816		probably benign	Het
Trpv4	C	T	5: 114,625,110	R746H	probably benign	Het
Txndc2	T	C	17: 65,638,972	D70G	probably damaging	Het
Ugcg	T	A	4: 59,219,530	I289N	possibly damaging	Het
Vmn2r2	C	G	3: 64,134,449	D282H	probably damaging	Het
Vmn2r50	A	T	7: 10,053,083	N32K	probably benign	Het
Zfp961	T	A	8: 71,966,114	C51S	possibly damaging	Het
Zxdc	C	T	6: 90,382,183	A599V	probably benign	Het

Other mutations in Wdpcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Wdpcp	APN	11	21659995	missense	probably damaging	1.00
IGL01322:Wdpcp	APN	11	21711949	missense	probably damaging	1.00
IGL01876:Wdpcp	APN	11	21813383	missense	possibly damaging	0.92
IGL01879:Wdpcp	APN	11	21711630	missense	probably damaging	0.99
IGL01913:Wdpcp	APN	11	21748931	missense	probably damaging	1.00
IGL02127:Wdpcp	APN	11	21711958	missense	possibly damaging	0.71
IGL03326:Wdpcp	APN	11	21885048	missense	probably benign	0.05
R0040:Wdpcp	UTSW	11	21711638	missense	probably damaging	1.00
R0040:Wdpcp	UTSW	11	21711638	missense	probably damaging	1.00
R0142:Wdpcp	UTSW	11	21857444	splice site	probably null
R2159:Wdpcp	UTSW	11	21857476	missense	probably benign	0.01
R2163:Wdpcp	UTSW	11	21885015	nonsense	probably null
R2165:Wdpcp	UTSW	11	21691884	missense	probably damaging	1.00
R4239:Wdpcp	UTSW	11	21695269	missense	probably damaging	1.00
R4239:Wdpcp	UTSW	11	21695271	missense	probably benign	0.35
R4636:Wdpcp	UTSW	11	21711568	missense	probably benign	0.03
R5558:Wdpcp	UTSW	11	21711732	missense	probably benign	0.00
R6493:Wdpcp	UTSW	11	21711631	missense	possibly damaging	0.83
R6678:Wdpcp	UTSW	11	21721105	missense	probably benign
R6957:Wdpcp	UTSW	11	21721154	missense	possibly damaging	0.94
R7380:Wdpcp	UTSW	11	21711585	missense	possibly damaging	0.52
R7458:Wdpcp	UTSW	11	21748919	missense	probably damaging	0.97
R7876:Wdpcp	UTSW	11	21711486	missense	probably benign	0.02
R8351:Wdpcp	UTSW	11	21748931	missense	probably damaging	1.00
R8503:Wdpcp	UTSW	11	21721205	nonsense	probably null
R8670:Wdpcp	UTSW	11	21695196	missense	probably benign	0.00
R8710:Wdpcp	UTSW	11	21660924	missense	probably benign	0.12
R9072:Wdpcp	UTSW	11	21664014	missense	probably benign	0.07
R9188:Wdpcp	UTSW	11	21660025	missense	probably damaging	1.00
R9242:Wdpcp	UTSW	11	21885040	missense	probably benign
R9332:Wdpcp	UTSW	11	21711522	missense	probably benign	0.15
R9673:Wdpcp	UTSW	11	21721285	missense	possibly damaging	0.51
RF021:Wdpcp	UTSW	11	21711587	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTTTGTGTAAAGAGTACCCTTG -3'
(R):5'- CCTCTGTGTTGACAAGTGCC -3'

Sequencing Primer
(F):5'- AAGAGTACCCTTGTTTCTGTTACTTG -3'
(R):5'- CTCTGTGTTGACAAGTGCCATACAG -3'

Posted On

2018-08-29