Incidental Mutation 'R6762:Rpa1'
ID 531753
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75340345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 73 (S73C)
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect possibly damaging
Transcript: ENSMUST00000000767
AA Change: S73C

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: S73C

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092907
AA Change: S73C

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: S73C

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Meta Mutation Damage Score 0.1077 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,668 Y27H probably benign Het
Angptl3 T A 4: 99,037,417 S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,117,050 probably benign Het
Cyp2s1 A T 7: 25,808,070 L318H probably damaging Het
Dnah14 T C 1: 181,757,259 L3185P probably damaging Het
Dnah7b T C 1: 46,224,742 V2128A probably benign Het
Ehhadh A T 16: 21,762,459 F594L probably benign Het
En2 A G 5: 28,170,353 N298S possibly damaging Het
Epha5 T A 5: 84,331,726 N140Y probably damaging Het
Fam151b C T 13: 92,468,050 V144I possibly damaging Het
Fanca C A 8: 123,271,303 A1215S probably benign Het
Fancd2 T A 6: 113,586,016 probably null Het
Fat2 T C 11: 55,253,482 probably null Het
Gm4513 T C 7: 20,594,193 N31S probably benign Het
Hspg2 A T 4: 137,551,803 I3066F possibly damaging Het
Krt10 T C 11: 99,387,057 T355A possibly damaging Het
Lims1 C A 10: 58,412,545 H275N probably damaging Het
Map3k19 C T 1: 127,847,264 G112D probably damaging Het
Mdn1 T A 4: 32,676,786 N619K possibly damaging Het
Mpp6 T A 6: 50,180,438 probably null Het
Mtor A G 4: 148,538,481 T1977A possibly damaging Het
Nos2 T G 11: 78,959,748 L1144R possibly damaging Het
Olfr1085 A T 2: 86,657,844 F205I probably benign Het
Olfr608 G C 7: 103,470,389 V117L probably benign Het
Olfr780 G A 10: 129,322,256 C211Y probably damaging Het
Pcdhga9 C A 18: 37,737,268 S50Y probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Prep T C 10: 45,148,123 probably null Het
Qtrt1 T A 9: 21,412,082 H76Q probably damaging Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Snapc3 T C 4: 83,435,258 L178P probably damaging Het
Sptbn4 A G 7: 27,394,208 F1340L probably damaging Het
Srd5a3 T A 5: 76,153,551 I85K probably benign Het
Taar2 C T 10: 23,941,402 T280M probably damaging Het
Tgfb3 T C 12: 86,069,463 D177G probably benign Het
Tpt1 A G 14: 75,846,381 D94G probably benign Het
Trpm4 A G 7: 45,304,816 probably benign Het
Trpv4 C T 5: 114,625,110 R746H probably benign Het
Txndc2 T C 17: 65,638,972 D70G probably damaging Het
Ugcg T A 4: 59,219,530 I289N possibly damaging Het
Vmn2r2 C G 3: 64,134,449 D282H probably damaging Het
Vmn2r50 A T 7: 10,053,083 N32K probably benign Het
Wdpcp C T 11: 21,721,244 T495I probably benign Het
Zfp961 T A 8: 71,966,114 C51S possibly damaging Het
Zxdc C T 6: 90,382,183 A599V probably benign Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R7938:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8837:Rpa1 UTSW 11 75313341 missense possibly damaging 0.70
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCAATGTTCGTCTGCATCC -3'
(R):5'- AACAGATACCATTTAGGAAGAGCCTC -3'

Sequencing Primer
(F):5'- GTTCGTCTGCATCCGGCTG -3'
(R):5'- AGAGCCTCAGACTTTTACATGGG -3'
Posted On 2018-08-29