Incidental Mutation 'R6762:Pfn4'
ID 531756
Institutional Source Beutler Lab
Gene Symbol Pfn4
Ensembl Gene ENSMUSG00000020639
Gene Name profilin family, member 4
Synonyms 2900024P18Rik
MMRRC Submission 044878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6762 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4819022-4828813 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4825487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 108 (M108K)
Ref Sequence ENSEMBL: ENSMUSP00000136765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020967] [ENSMUST00000178879] [ENSMUST00000219438] [ENSMUST00000219503]
AlphaFold Q9D6I3
Predicted Effect probably damaging
Transcript: ENSMUST00000020967
AA Change: M108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020967
Gene: ENSMUSG00000020639
AA Change: M108K

DomainStartEndE-ValueType
Pfam:Profilin 4 124 5.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178879
AA Change: M108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136765
Gene: ENSMUSG00000020639
AA Change: M108K

DomainStartEndE-ValueType
Pfam:Profilin 5 124 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219438
Predicted Effect probably damaging
Transcript: ENSMUST00000219503
AA Change: M108K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6360 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 103,976,867 (GRCm39) Y27H probably benign Het
Angptl3 T A 4: 98,925,654 (GRCm39) S327T possibly damaging Het
Arl6ip4 GGAAGAAGAAGAAGAAGAA GGAAGAAGAAGAAGAAGAAGAA 5: 124,255,113 (GRCm39) probably benign Het
Cyp2s1 A T 7: 25,507,495 (GRCm39) L318H probably damaging Het
Dnah14 T C 1: 181,584,824 (GRCm39) L3185P probably damaging Het
Dnah7b T C 1: 46,263,902 (GRCm39) V2128A probably benign Het
Ehhadh A T 16: 21,581,209 (GRCm39) F594L probably benign Het
En2 A G 5: 28,375,351 (GRCm39) N298S possibly damaging Het
Epha5 T A 5: 84,479,585 (GRCm39) N140Y probably damaging Het
Fam151b C T 13: 92,604,558 (GRCm39) V144I possibly damaging Het
Fanca C A 8: 123,998,042 (GRCm39) A1215S probably benign Het
Fancd2 T A 6: 113,562,977 (GRCm39) probably null Het
Fat2 T C 11: 55,144,308 (GRCm39) probably null Het
Gm4513 T C 7: 20,328,118 (GRCm39) N31S probably benign Het
Hspg2 A T 4: 137,279,114 (GRCm39) I3066F possibly damaging Het
Krt10 T C 11: 99,277,883 (GRCm39) T355A possibly damaging Het
Lims1 C A 10: 58,248,367 (GRCm39) H275N probably damaging Het
Map3k19 C T 1: 127,775,001 (GRCm39) G112D probably damaging Het
Mdn1 T A 4: 32,676,786 (GRCm39) N619K possibly damaging Het
Mtor A G 4: 148,622,938 (GRCm39) T1977A possibly damaging Het
Nos2 T G 11: 78,850,574 (GRCm39) L1144R possibly damaging Het
Or52ae7 G C 7: 103,119,596 (GRCm39) V117L probably benign Het
Or6c68 G A 10: 129,158,125 (GRCm39) C211Y probably damaging Het
Or8k38 A T 2: 86,488,188 (GRCm39) F205I probably benign Het
Pals2 T A 6: 50,157,418 (GRCm39) probably null Het
Pcdhga9 C A 18: 37,870,321 (GRCm39) S50Y probably damaging Het
Prep T C 10: 45,024,219 (GRCm39) probably null Het
Qtrt1 T A 9: 21,323,378 (GRCm39) H76Q probably damaging Het
Rpa1 T A 11: 75,231,171 (GRCm39) S73C possibly damaging Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Snapc3 T C 4: 83,353,495 (GRCm39) L178P probably damaging Het
Sptbn4 A G 7: 27,093,633 (GRCm39) F1340L probably damaging Het
Srd5a3 T A 5: 76,301,398 (GRCm39) I85K probably benign Het
Taar2 C T 10: 23,817,300 (GRCm39) T280M probably damaging Het
Tgfb3 T C 12: 86,116,237 (GRCm39) D177G probably benign Het
Tpt1 A G 14: 76,083,821 (GRCm39) D94G probably benign Het
Trpm4 A G 7: 44,954,240 (GRCm39) probably benign Het
Trpv4 C T 5: 114,763,171 (GRCm39) R746H probably benign Het
Txndc2 T C 17: 65,945,967 (GRCm39) D70G probably damaging Het
Ugcg T A 4: 59,219,530 (GRCm39) I289N possibly damaging Het
Vmn2r2 C G 3: 64,041,870 (GRCm39) D282H probably damaging Het
Vmn2r50 A T 7: 9,787,010 (GRCm39) N32K probably benign Het
Wdpcp C T 11: 21,671,244 (GRCm39) T495I probably benign Het
Zfp961 T A 8: 72,719,958 (GRCm39) C51S possibly damaging Het
Zxdc C T 6: 90,359,165 (GRCm39) A599V probably benign Het
Other mutations in Pfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Pfn4 APN 12 4,825,505 (GRCm39) missense probably damaging 1.00
IGL01522:Pfn4 APN 12 4,820,240 (GRCm39) missense probably benign 0.01
IGL01726:Pfn4 APN 12 4,824,446 (GRCm39) missense probably benign 0.00
IGL02896:Pfn4 APN 12 4,825,451 (GRCm39) missense probably benign 0.02
R2082:Pfn4 UTSW 12 4,825,439 (GRCm39) splice site probably null
R2201:Pfn4 UTSW 12 4,824,382 (GRCm39) splice site probably null
R4373:Pfn4 UTSW 12 4,820,182 (GRCm39) missense probably damaging 0.99
R4376:Pfn4 UTSW 12 4,820,182 (GRCm39) missense probably damaging 0.99
R4377:Pfn4 UTSW 12 4,820,182 (GRCm39) missense probably damaging 0.99
R4692:Pfn4 UTSW 12 4,824,486 (GRCm39) missense probably damaging 1.00
R7711:Pfn4 UTSW 12 4,824,414 (GRCm39) missense possibly damaging 0.77
R8125:Pfn4 UTSW 12 4,825,487 (GRCm39) missense probably damaging 1.00
R8861:Pfn4 UTSW 12 4,825,456 (GRCm39) missense probably benign 0.03
R9300:Pfn4 UTSW 12 4,825,442 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCAGAGATACACGCCATGAAGC -3'
(R):5'- ATACGCGGCACCTGCATTTC -3'

Sequencing Primer
(F):5'- CCCCTGTTAGGCACAAGAGTTATG -3'
(R):5'- GGCACCTGCATTTCCCATGG -3'
Posted On 2018-08-29