Incidental Mutation 'R6763:Fam129b'
ID531768
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32911448 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028135] [ENSMUST00000138781]
Predicted Effect probably null
Transcript: ENSMUST00000028135
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138781
SMART Domains Protein: ENSMUSP00000114232
Gene: ENSMUSG00000026796

DomainStartEndE-ValueType
Blast:PH 53 83 2e-15 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
E130308A19Rik A T 4: 59,752,288 K467M probably damaging Het
Garnl3 T C 2: 33,054,196 Y117C probably damaging Het
Gas2l3 T C 10: 89,413,369 Y629C probably benign Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Lrba A G 3: 86,354,263 D1508G probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nln A T 13: 104,035,655 W638R probably damaging Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7769:Fam129b UTSW 2 32919832 missense possibly damaging 0.93
R7888:Fam129b UTSW 2 32922125 nonsense probably null
R7971:Fam129b UTSW 2 32922125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAACATTTTATGTGGCTGC -3'
(R):5'- TTGTAGGCCTTCGAGTCTCC -3'

Sequencing Primer
(F):5'- TCCAAACCTTGAACTAGTAGCTGAG -3'
(R):5'- CTTCGAGTCTCCTCTTTGGGG -3'
Posted On2018-08-29