Incidental Mutation 'R6763:Garnl3'
ID531769
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33054196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 117 (Y117C)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: Y76C

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: Y72C

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124000
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect possibly damaging
Transcript: ENSMUST00000133135
AA Change: Y117C

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: Y117C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
E130308A19Rik A T 4: 59,752,288 K467M probably damaging Het
Fam129b T C 2: 32,911,448 probably null Het
Gas2l3 T C 10: 89,413,369 Y629C probably benign Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Lrba A G 3: 86,354,263 D1508G probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nln A T 13: 104,035,655 W638R probably damaging Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTGAGTTGAAGCTTTTAGCC -3'
(R):5'- GACAGCCCTTATTCGTGTGC -3'

Sequencing Primer
(F):5'- GTTGAAGCTTTTAGCCCACGAAG -3'
(R):5'- GACAGCCCTTATTCGTGTGCTTTTAG -3'
Posted On2018-08-29