Incidental Mutation 'R6763:E130308A19Rik'
ID531772
Institutional Source Beutler Lab
Gene Symbol E130308A19Rik
Ensembl Gene ENSMUSG00000045071
Gene NameRIKEN cDNA E130308A19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location59626211-59761439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59752288 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 467 (K467M)
Ref Sequence ENSEMBL: ENSMUSP00000065702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070150]
Predicted Effect probably damaging
Transcript: ENSMUST00000070150
AA Change: K467M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065702
Gene: ENSMUSG00000045071
AA Change: K467M

DomainStartEndE-ValueType
low complexity region 130 141 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
Pfam:DUF3504 532 687 4.5e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
Fam129b T C 2: 32,911,448 probably null Het
Garnl3 T C 2: 33,054,196 Y117C probably damaging Het
Gas2l3 T C 10: 89,413,369 Y629C probably benign Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Lrba A G 3: 86,354,263 D1508G probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nln A T 13: 104,035,655 W638R probably damaging Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in E130308A19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:E130308A19Rik APN 4 59737743 splice site probably benign
IGL00672:E130308A19Rik APN 4 59719697 missense probably benign 0.00
IGL00937:E130308A19Rik APN 4 59690846 missense probably benign 0.01
IGL01885:E130308A19Rik APN 4 59720004 missense probably benign 0.20
IGL02638:E130308A19Rik APN 4 59719676 nonsense probably null
H8562:E130308A19Rik UTSW 4 59691033 missense possibly damaging 0.70
R0044:E130308A19Rik UTSW 4 59690290 missense possibly damaging 0.86
R0523:E130308A19Rik UTSW 4 59719716 missense probably damaging 0.98
R0788:E130308A19Rik UTSW 4 59719847 missense possibly damaging 0.76
R1215:E130308A19Rik UTSW 4 59690743 missense probably benign 0.37
R1490:E130308A19Rik UTSW 4 59719746 missense probably damaging 0.99
R2292:E130308A19Rik UTSW 4 59690579 missense probably damaging 0.99
R3907:E130308A19Rik UTSW 4 59752393 missense probably benign 0.14
R4288:E130308A19Rik UTSW 4 59690308 missense probably benign 0.33
R4780:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4781:E130308A19Rik UTSW 4 59691057 missense probably benign 0.01
R4834:E130308A19Rik UTSW 4 59690317 nonsense probably null
R4985:E130308A19Rik UTSW 4 59691017 missense probably benign 0.01
R6123:E130308A19Rik UTSW 4 59737565 missense probably damaging 1.00
R6290:E130308A19Rik UTSW 4 59691332 missense probably benign 0.25
R6315:E130308A19Rik UTSW 4 59691132 missense probably benign
R6643:E130308A19Rik UTSW 4 59720561 missense possibly damaging 0.90
R6980:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7036:E130308A19Rik UTSW 4 59719991 missense probably damaging 0.97
R7078:E130308A19Rik UTSW 4 59737688 missense probably damaging 1.00
R7098:E130308A19Rik UTSW 4 59753004 missense possibly damaging 0.88
R7171:E130308A19Rik UTSW 4 59690333 missense probably damaging 1.00
R7247:E130308A19Rik UTSW 4 59690502 missense probably damaging 1.00
R7366:E130308A19Rik UTSW 4 59752770 missense probably damaging 0.99
R7916:E130308A19Rik UTSW 4 59719841 missense probably damaging 1.00
R8050:E130308A19Rik UTSW 4 59719767 missense probably damaging 1.00
R8445:E130308A19Rik UTSW 4 59720526 missense probably damaging 0.99
Z1176:E130308A19Rik UTSW 4 59720313 missense probably damaging 1.00
Z1177:E130308A19Rik UTSW 4 59720223 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGAAGGGTTTGATCCTC -3'
(R):5'- CTCCTCATCAGAAAGGGAGAAGTAG -3'

Sequencing Primer
(F):5'- CTAGAGGTCAAGAAACTGTCCTCTTC -3'
(R):5'- AGTAGACGATATTGCGGGAAC -3'
Posted On2018-08-29